Plunc (BPIFA1) (NM_130852) Human Untagged Clone

SKU
SC305921
BPIFA1 (untagged)-Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Plunc
Synonyms bA49G10.5; LUNX; NASG; PLUNC; SPLUNC1; SPURT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC305921 representing NM_130852.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTTCAAACTGGGGGCCTCATTGTCTTCTACGGGCTGTTAGCCCAGACCATGGCCCAGTTTGGAGGC
CTGCCCGTGCCCCTGGACCAGACCCTGCCCTTGAATGTGAATCCAGCCCTGCCCTTGAGTCCCACAGGT
CTTGCAGGAAGCTTGACAAATGCCCTCAGCAATGGCCTGCTGTCTGGGGGCCTGTTGGGCATTCTGGAA
AACCTTCCGCTCCTGGACATCCTGAAGCCTGGAGGAGGTACTTCTGGTGGCCTCCTTGGGGGACTGCTT
GGAAAAGTGACGTCAGTGATTCCTGGCCTGAACAACATCATTGACATAAAGGTCACTGACCCCCAGCTG
CTGGAACTTGGCCTTGTGCAGAGCCCTGATGGCCACCGTCTCTATGTCACCATCCCTCTCGGCATAAAG
CTCCAAGTGAATACGCCCCTGGTCGGTGCAAGTCTGTTGAGGCTGGCTGTGAAGCTGGACATCACTGCA
GAAATCTTAGCTGTGAGAGATAAGCAGGAGAGGATCCACCTGGTCCTTGGTGACTGCACCCATTCCCCT
GGAAGCCTGCAAATTTCTCTGCTTGATGGACTTGGCCCCCTCCCCATTCAAGGTCTTCTGGACAGCCTC
ACAGGGATCTTGAATAAAGTCCTGCCTGAGTTGGTTCAGGGCAACGTGTGCCCTCTGGTCAATGAGGTT
CTCAGAGGCTTGGACATCACCCTGGTGCATGACATTGTTAACATGCTGATCCACGGACTACAGTTTGTC
ATCAAGGTCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_130852
Insert Size 771 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_130852.2
RefSeq Size 1090 bp
RefSeq ORF 771 bp
Locus ID 51297
UniProt ID Q9NP55
Cytogenetics 20q11.21
Protein Families Secreted Protein
MW 26.7 kDa
Summary This gene is the human homolog of murine plunc, and like the mouse gene, is specifically expressed in the upper airways and nasopharyngeal regions. The encoded antimicrobial protein displays antibacterial activity against Gram-negative bacteria. It is thought to be involved in inflammatory responses to irritants in the upper airways and may also serve as a potential molecular marker for detection of micrometastasis in non-small-cell lung cancer. Multiple transcript variants resulting from alternative splicing in the 3' UTR have been detected, but the full-length nature of only three are known. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (2) represents the longest transcript. All three variants encode the same protein.
Write Your Own Review
You're reviewing:Plunc (BPIFA1) (NM_130852) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203060 BPIFA1 (Myc-DDK-tagged)-Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2 10 ug
$300.00
RC203060L1 Lenti ORF clone of Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC203060L2 Lenti ORF clone of Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2, mGFP tagged 10 ug
$600.00
RC203060L3 Lenti ORF clone of Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC203060L4 Lenti ORF clone of Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2, mGFP tagged 10 ug
$600.00
RG203060 BPIFA1 (tGFP-tagged) - Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC320871 BPIFA1 (untagged)-Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.