UPF3A (NM_080687) Human Untagged Clone

SKU
SC305816
UPF3A (untagged)-Human UPF3 regulator of nonsense transcripts homolog A (yeast) (UPF3A), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol UPF3A
Synonyms HUPF3A; RENT3A; UPF3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC305816 representing NM_080687.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGCTCGGAAAAGGAGGGGGCCGGAGGCCTTCGGGCGGCCGTTGCCGCGCGGGGCCCGAGCGGGAGG
GAGAAGCTGTCGGCCCTAGAAGTGCAGTTCCACCGCGACTCGCAGCAGCAGGAGGCTGAGACGCCGCCA
ACTTCGTCCTCCGGTTGCGGGGGCGGTGCGGGCAAACCTCGCGAGGAGAAGAGGACGGCCCTGAGCAAG
GTGGTCATCCGCCGCCTGCCTCCGGGCCTCACCAAGGAGCAGCTGGAGGAGCAGCTGCGCCCGCTGCCA
GCACACGACTACTTCGAGTTCTTCGCCGCCGACCTGAGTCTTTATCCTCATCTCTACTCAAGAGCATAC
ATTAATTTTAGGAATCCTGATGACATCCTTCTTTTTAGAGATCGTTTTGATGGATATATCTTCCTTGAC
AGCAAAGATCCAGAATATAAGAAGTTTTTAGAAACCTACTGTGTGGAGGAAGAGAAGACCAGTGCCAAC
CCTGAGACTCTGCTGGGGGAGATGGAGGCGAAGACAAGAGAGCTCATTGCTAGAAGAACCACACCTCTT
TTGGAATATATTAAAAATAGAAAATTAGAAAAGCAGAGAATTCGAGAAGAGAAGCGAGAAGAACGGAGG
AGGAGAGAGTTAGAAAAGAAACGTTTGCGGGAAGAGGAAAAAAGAAGAAGAAGAGAAGAAGAAAGATGC
AAAAAAAAAGAGACAGATAAACAGAAGAAAATTGCAGAGAAAGAAGTAAGGATTAAGCTTCTTAAGAAA
CCAGAAAAGGGAGAGGAACCAACCACAGAGAAACCAAAAGAAAGAGGAGAGGAGATTGATACTGGAGGT
GGCAAGCAGGAATCCTGTGCCCCCGGTGCAGTCGTAAAAGCCAGGCCCATGGAAGGCTCGCTGGAGGAG
CCCCAGGAGACGTCACACAGCGGCAGTGATAAAGAGCACAGGGATGTGGAGAGATCTCAAGAACAAGAA
TCTGAAGCACAAAGATACCATGTGGATGACGGCAGGAGGCACAGAGCTCACCACGAGCCTGAACGGCTT
TCCAGAAGGAGTGAGGATGAGCAGAGATGGGGGAAAGGACCTGGCCAAGACAGAGGGAAGAAGGGGAGC
CAGGACAGCGGGGCTCCGGGGGAGGCCATGGAGAGACTGGGAAGAGCGCAGAGGTGTGACGACAGTCCA
GCACCCAGAAAAGAGCGACTGGCAAACAAGGACCGGCCAGCCTTGCAGCTGTATGATCCAGGAGCTCGC
TTCCGAGCGCGAGAGTGTGGCGGAAACAGGAGGATCTGCAAGGCAGAAGGTTCGGGGACTGGTCCTGAG
AAGAGGGAAGAGGCAGAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_080687
Insert Size 1332 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_080687.2
RefSeq Size 2303 bp
RefSeq ORF 1332 bp
Locus ID 65110
UniProt ID Q9H1J1
Cytogenetics 13q34
MW 51 kDa
Summary This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. The encoded protein is one of two functional homologs to yeast Upf3p. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. It forms with Y14 a complex that binds specifically 20 nt upstream of exon-exon junctions. This gene is located on the long arm of chromosome 13. Several splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2017]
Transcript Variant: This variant (2) lacks an in-frame exon in the 5' coding region, compared to transcript variant 1. The resulting isoform (hUpf3pdelta) lacks an internal segment, compared to isoform hUpf3p.
Write Your Own Review
You're reviewing:UPF3A (NM_080687) Human Untagged Clone
Your Rating
SKU Description Size Price
RC204333 UPF3A (Myc-DDK-tagged)-Human UPF3 regulator of nonsense transcripts homolog A (yeast) (UPF3A), transcript variant 2 10 ug
$457.00
RC204333L3 Lenti ORF clone of Human UPF3 regulator of nonsense transcripts homolog A (yeast) (UPF3A), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC204333L4 Lenti ORF clone of Human UPF3 regulator of nonsense transcripts homolog A (yeast) (UPF3A), transcript variant 2, mGFP tagged 10 ug
$757.00
RG204333 UPF3A (tGFP-tagged) - Human UPF3 regulator of nonsense transcripts homolog A (yeast) (UPF3A), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.