DEFB118 (NM_054112) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | DEFB118 |
Synonyms | C20orf63; DEFB-18; ESC42; ESP13.6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC305733 representing NM_054112.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAACTCCTGCTGCTGGCTCTTCCTATGCTTGTGCTCCTACCCCAAGTGATCCCAGCCTATAGTGGT GAAAAAAAATGCTGGAACAGATCAGGGCACTGCAGGAAACAATGCAAAGATGGAGAAGCAGTGAAAGAT ACATGCAAAAATCTTCGAGCTTGCTGCATTCCATCCAATGAAGACCACAGGCGAGTTCCTGCGACATCT CCCACACCCTTGAGTGACTCAACACCAGGAATTATTGATGATATTTTAACAGTAAGGTTCACGACAGAC TACTTTGAAGTAAGCAGCAAGAAAGATATGGTTGAAGAGTCTGAGGCGGGAAGGGGAACTGAGACCTCT CTTCCAAATGTTCACCATAGCTCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_054112 |
Insert Size | 372 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_054112.2 |
RefSeq Size | 1158 bp |
RefSeq ORF | 372 bp |
Locus ID | 117285 |
UniProt ID | Q96PH6 |
Cytogenetics | 20q11.21 |
Protein Families | Secreted Protein |
MW | 13.6 kDa |
Summary | This gene encodes a member of the beta subfamily of defensins. Beta-defensins are antimicrobial peptides that protect tissues and organs from infection by a variety of microorganisms. Expression of this gene is regulated by androgen, and the encoded protein binds to sperm and exhibits antibacterial activity against E. coli. This gene is found in a cluster with other beta-defensin genes on the long arm of chromosome 20. [provided by RefSeq, Nov 2014] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC221558 | DEFB118 (Myc-DDK-tagged)-Human defensin, beta 118 (DEFB118) | 10 ug |
$150.00
|
|
RC221558L3 | Lenti ORF clone of Human defensin, beta 118 (DEFB118), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC221558L4 | Lenti ORF clone of Human defensin, beta 118 (DEFB118), mGFP tagged | 10 ug |
$450.00
|
|
RG221558 | DEFB118 (tGFP-tagged) - Human defensin, beta 118 (DEFB118) | 10 ug |
$489.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.