CGB1 (NM_033377) Human Untagged Clone

SKU SC305620

CGB1 (untagged)-Human chorionic gonadotropin, beta polypeptide 1 (CGB1)

Product Data

• Type: Human Untagged Clone
• Target Symbol: CGB1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC305620 representing NM_033377.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGTCAAAGAGGCTGCTGCTGTTGCTGCTGCTGAGCATGGGCGGGACATGGGCATCCAAGGAGCCGCTT; CGGCCACGGTGCCGCCCCATCAATGCCACCCTGGCTGTGGAGAAGGAGGGCTGCCCCGTGTGCATCACC; GTCAACACCACCATCTGTGCCGGCTACTGCCCCACCATGACCCGCGTGCTGCAGGGGGTCCTGCCGGCC; CTGCCTCAGGTGGTGTGCAACTACCGCGATGTGCGCTTCGAGTCCATCCGGCTCCCTGGCTGCCCGCGC; GGCGTGAACCCCGTGGTCTCCTACGCCGTGGCTCTCAGCTGTCAATGTGCACTCTGCCGCCGCAGCACC; ACTGACTGCGGGGGTCCCAAGGACCACCCCTTGACCTGTGATGACCCCCGCTTCCAGGACTCCTCTTCC; TCAAAGGCCCCTCCCCCCAGCCTTCCAAGTCCATCCCGTCTCCCGGGGCCCTAG; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_033377
• Insert Size: 468 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_033377.1
• RefSeq Size: 732 bp
• RefSeq ORF: 468 bp
• Locus ID: 114335
• UniProt ID: A6NKQ9
• Cytogenetics: 19q13.33
• Protein Families: Druggable Genome
• MW: 16.7 kDa
• Summary: The beta subunit of chorionic gonadotropin (CGB) is encoded by six highly homologous and structurally similar genes that are arranged in tandem and inverted pairs on chromosome 19q13.3, and contiguous with the luteinizing hormone beta (LHB) subunit gene. The CGB genes are primarily distinguished by differences in the 5' untranscribed region. This gene was originally thought to be one of the two pseudogenes (CGB1 and CGB2) of CGB subunit, however, detection of CGB1 and CGB2 transcripts in vivo, and their presence on the polysomes, suggested that these transcripts are translated. To date, a protein product corresponding to CGB1 has not been isolated. The deduced sequence of the hypothetical protein of 132 aa does not share any similarity with that of functional CGB subunits (PMID:8954017). However, a 155 aa protein, translated from a different frame, is about the same size, and shares 98% identity with other CGB subunits. [provided by RefSeq, Jul 2008]