GALP (NM_033106) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | GALP |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_033106 edited
CTGTAGGCACCTGTCGTCCTGCCTTCGATGGCTCCTCCCTCCGTCCCCCTGGTCCTCCTC CTCGTCCTCTTGCTGAGCCTGGCAGAGACTCCAGCATCCGCACCTGCCCACCGGGGACGA GGAGGCTGGACCCTCAATAGTGCTGGCTACCTTCTGGGTCCCGTCCTCCACCTTCCCCAA ATGGGTGACCAAGACGGAAAGAGGGAGACAGCCCTTGAGATCCTAGACCTGTGGAAGGCC ATCGACGGGCTCCCCTACTCCCACCCTCCACAGCCCTCCAAGAGGAATGTGATGGAGACG TTTGCCAAACCAGAGATTGGAGATCTGGGCATGCTCAGCATGAAAATTCCCAAGGAGGAA GATGTCCTGAAGTCATAGATGTCTTCAAATCCCTGTTCCTATCCTTCTTCTCCAGCTCCT CCTG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_033106 unedited
GTCAGCATTTGTATACGACTCATATAGGCGGCCGCGNATTCGCCCTTAGCTGTAGGCACC TGTCGTCCTGCCTTCGATGGCTCCTCCCTCCGTCCCCCTGGTCCTCCTCCTCGTCCTCTT GCTGAGCCTGGCAGAGACTCCAGCATCCGCACCTGCCCACCGGGGACGAGGAGGCTGGAC CCTCAATAGTGCTGGCTACCTTCTGGGTCCCGTCCTCCACCTTCCCCAAATGGGTGACCA AGACGGAAAGAGGGAGACAGCCCTTGAGATCCTAGACCTGTGGAAGGCCATCGACGGGCT CCCCTACTCCCACCCTCCACAGCCCTCCAAGAGGAATGTGATGGAGACGTTTGCCAAACC AGAGATTGGAGATCTGGGCATGCTCAGCATGAAAATTCCCAAGGAGGAAGATGTCCTGAA GTCATAGATGTCTTCAAATCCCTGTTCCTATCCTTCTTCTCCAGCTCCTCCTGAAGGGCG AATTCAGATCTGGTACCGATATCAAGCTTGTCGACTCTAGATTGCGGCCGCGGTCATAGC TGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGC CCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCAT TTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTTGGTATGGAAGC AGGGGGCAAGTTGGGAAGACNACCTGNTAGGCCTGNCGGGTCTATTGGGAACCAAGCTGN AGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGGCTTCTGGGTTCAAGCGATTCTC CTGCCTCA |
Restriction Sites | Please inquire |
ACCN | NM_033106 |
Insert Size | 400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_033106.1, NP_149097.1 |
RefSeq Size | 947 bp |
RefSeq ORF | 351 bp |
Locus ID | 85569 |
UniProt ID | Q9UBC7 |
Cytogenetics | 19q13.43 |
Protein Families | Secreted Protein |
Summary | This gene encodes a member of the galanin family of neuropeptides. The encoded protein binds galanin receptors 1, 2 and 3 with the highest affinity for galanin receptor 3 and has been implicated in biological processes involving the central nervous system including hypothalamic regulation of metabolism and reproduction. A peptide encoded by a splice variant of this gene, termed alarin, has vasoactive properties, displays antimicrobial activity against E. coli, and may serve as a marker for neuroblastic tumors.[provided by RefSeq, Nov 2014] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC216301 | GALP (Myc-DDK-tagged)-Human galanin-like peptide (GALP), transcript variant 1 | 10 ug |
$150.00
|
|
RC216301L1 | Lenti ORF clone of Human galanin-like peptide (GALP), transcript variant 1, Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC216301L2 | Lenti ORF clone of Human galanin-like peptide (GALP), transcript variant 1, mGFP tagged | 10 ug |
$450.00
|
|
RC216301L3 | Lenti ORF clone of Human galanin-like peptide (GALP), transcript variant 1, Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC216301L4 | Lenti ORF clone of Human galanin-like peptide (GALP), transcript variant 1, mGFP tagged | 10 ug |
$450.00
|
|
RG216301 | GALP (tGFP-tagged) - Human galanin-like peptide (GALP), transcript variant 1 | 10 ug |
$489.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.