KRTAP9-3 (NM_031962) Human Untagged Clone

SKU
SC305381
KRTAP9 (untagged)-Human keratin associated protein 9-3 (KRTAP9-3)
$165.00
Please Inquire*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol KRTAP9-3
Synonyms KAP9.3; KRTAP9.3
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_031962, the custom clone sequence may differ by one or more nucleotides
ATGACCCACTGTTGCTCCCCTTGCTGTCAGCCTACCTGCTGCAGGACCACCTGCTGGCAG
CCCACCACTGTGACCACCTGCAGCAGCACACCCTGCTGTCAGCCCTCCTGCTGTGTTTCC
AGCTGCTGCCAGCCTTGCTGCCACCCAACTTGCTGTCAAAACACCTGCTGTAGGACCACC
TGCTGCCAGCCCATCTGTGTGACCAGCTGCTGCCAGCCTTCCTGCTGTAGCACACCCTGC
TGCCAGCCCACATGCTGTGGGTCCAGCTGTGGTCAGAGCAGCTCCTGTGCACCTGTGTAC
TGCAGAAGAACCTGCTACCACCCCACAAGTGTTTGTCTGCCTGGTTGCCTAAACCAGAGC
TGTGGCTCCAACTGCTGCCAGCCCTGCTGCCGCCCAGCCTGCTGTGAGACCACCTGCTGC
AGGACCACTTGTTTCCAGCCCACCTGTGTGTACAGCTGCTGCCAGCCTTCTTGCTGCTAA
Restriction Sites Please inquire
ACCN NM_031962
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_031962.2, NP_114168.1
RefSeq Size 1020 bp
RefSeq ORF 480 bp
Locus ID 83900
UniProt ID Q9BYQ3
Cytogenetics 17q21.2
Summary This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the ultrahigh sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:KRTAP9-3 (NM_031962) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210405 KRTAP9 (Myc-DDK-tagged)-Human keratin associated protein 9-3 (KRTAP9-3). Note: ORF is codon optimized 10 ug
$289.00
RG210405 KRTAP9 (tGFP-tagged) - Human keratin associated protein 9-3 (KRTAP9-3). Note: ORF is codon optimized 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.