GNGT2 (NM_031498) Human Untagged Clone

SKU
SC305349
GNGT2 (untagged)-Human guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 (GNGT2), transcript variant 1
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GNGT2
Synonyms G-GAMMA-8; G-GAMMA-C; GNG9; GNGT8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC305349 representing NM_031498.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCCAGGATCTCAGCGAGAAGGACCTGTTGAAGATGGAGGTGGAGCAGCTGAAGAAAGAAGTGAAA
AACACAAGAATTCCGATTTCCAAAGCGGGAAAGGAAATCAAGGAGTACGTGGAGGCCCAAGCAGGAAAC
GATCCTTTTCTCAAAGGCATCCCTGAGGACAAGAATCCCTTCAAGGAGAAAGGTGGCTGTCTGATAAGC
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_031498
Insert Size 210 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_031498.2
RefSeq Size 1057 bp
RefSeq ORF 210 bp
Locus ID 2793
UniProt ID O14610
Cytogenetics 17q21.32
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway
MW 7.7 kDa
Summary Phototransduction in rod and cone photoreceptors is regulated by groups of signaling proteins. The encoded protein is thought to play a crucial role in cone phototransduction. It belongs to the G protein gamma family and localized specifically in cones. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (1) represents the longest transcript. All four variants encode the same protein.
Write Your Own Review
You're reviewing:GNGT2 (NM_031498) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203892 GNGT2 (Myc-DDK-tagged)-Human guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 (GNGT2), transcript variant 1 10 ug
$150.00
RC203892L3 Lenti ORF clone of Human guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 (GNGT2), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC203892L4 Lenti ORF clone of Human guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 (GNGT2), transcript variant 1, mGFP tagged 10 ug
$450.00
RG203892 GNGT2 (tGFP-tagged) - Human guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 (GNGT2), transcript variant 1 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.