C22orf13 (GUCD1) (NM_031444) Human Untagged Clone

SKU
SC305342
GUCD1 (untagged)-Human chromosome 22 open reading frame 13 (C22orf13)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C22orf13
Synonyms C22orf13; LLN4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC305342 representing NM_031444.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGGACGGAGGCGGAGGCAGCGGGGCCGCCGCTCGAGCCCGGGGACTTTGTGCAACTGCCTGTGCCC
GTCATCCAGCAGCTCTACCACTGGGACTGTGGCCTGGCCTGCTCCAGGATGGTGCTGCGGTACCTGGGC
CAGCTGGACGACAGTGAGTTTGAGAGAGCCCTGCAGAAGCTGCAGCTGACCAGGAGCATCTGGACCATC
GACCTGGCCTACCTGATGCACCACTTTGGCGTGAGGCACCGCTTCTGTACCCAGACCCTGGGTGTCGAC
AAGGGCTACAAGAACCAGTCCTTCTACAGGAAGCACTTTGACACAGAAGAGACCCGGGTGAATCAGCTG
TTTGCACAAGCAAAGGCCTGCAAGGTGCTGGTGGAGAAATGCACAGTGAGTGTGAAGGACATCCAGGCG
CACCTGGCTCAGGGCCATGTGGCCATCGTGCTGGTGAACTCGGGGGTGCTGCACTGTGACCTGTGCTCC
AGCCCTGTCAAGTACTGCTGCTTCACCCCCAGTGGCCACCACTGCTTCTGCCGCACTCCTGACTACCAG
GGCCACTTCATCGTGCTGCGTGGCTACAACCGGGCCACTGGCTGCATCTTCTACAACAACCCAGCCTAT
GCCGACCCAGGAATGTGCAGCACCAGCATCAGTAACTTTGAGGAGGCCAGAACCAGCTATGGCACAGAT
GAGGACATCCTCTTTGTCTACTTGGACAGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_031444
Insert Size 723 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_031444.3
RefSeq Size 3630 bp
RefSeq ORF 723 bp
Locus ID 83606
UniProt ID Q96NT3
Cytogenetics 22q11.23
MW 27.2 kDa
Write Your Own Review
You're reviewing:C22orf13 (GUCD1) (NM_031444) Human Untagged Clone
Your Rating
SKU Description Size Price
RC209887 GUCD1 (Myc-DDK-tagged)-Human chromosome 22 open reading frame 13 (C22orf13) 10 ug
$1,072.00
RC209887L3 Lenti ORF clone of Human chromosome 22 open reading frame 13 (C22orf13), Myc-DDK-tagged 10 ug
$1,372.00
RC209887L4 Lenti ORF clone of Human chromosome 22 open reading frame 13 (C22orf13), mGFP tagged 10 ug
$1,372.00
RG209887 GUCD1 (tGFP-tagged) - Human chromosome 22 open reading frame 13 (C22orf13) 10 ug
$489.00 MSRP $1,272.00 MSRP $1,272.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.