MYCT1 (NM_025107) Human Untagged Clone

SKU
SC305235
MYCT1 (untagged)-Human myc target 1 (MYCT1)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MYCT1
Synonyms MTLC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC305235 representing NM_025107.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGAACACAAGTATATGAGGGGTTGTGTAAAAATTATTTTTCTCTTGCTGTACTACAAAGAGATAGA
ATCAAACTGCTTTTTTTCGACATACTGGTTTTTCTTTCTGTTTTTCTTCTCTTTCTTCTATTTCTTGTG
GATATTATGGCTAATAACACAACAAGTTTAGGGAGTCCATGGCCAGAAAACTTTTGGGAGGACCTTATC
ATGTCCTTCACTGTATCCATGGCAATCGGGCTGGTACTTGGAGGATTTATTTGGGCTGTGTTCATTTGT
CTGTCTCGAAGAAGAAGAGCCAGTGCTCCCATCTCACAGTGGAGTTCAAGCAGGAGATCTAGGTCTTCT
TACACCCACGGCCTCAACAGAACTGGATTTTACCGCCACAGTGGCTGTGAACGTCGAAGCAACCTCAGC
CTGGCCAGTCTCACCTTCCAGCGACAAGCTTCCCTGGAACAAGCAAATTCCTTTCCAAGAAAATCAAGT
TTCAGAGCTTCTACTTTCCATCCCTTTCTGCAATGTCCACCACTTCCTGTGGAAACTGAGAGTCAGCTG
GTGACTCTCCCTTCTTCCAATATCTCTCCCACCATCAGCACTTCCCACAGTCTGAGCCGTCCTGACTAC
TGGTCCAGTAACAGTCTTCGAGTGGGCCTTTCAACACCGCCCCCACCTGCCTATGAGTCCATCATCAAG
GCATTCCCAGATTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_025107
Insert Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_025107.2
RefSeq Size 3066 bp
RefSeq ORF 708 bp
Locus ID 80177
UniProt ID Q8N699
Cytogenetics 6q25.2
Protein Families Transmembrane
MW 26.6 kDa
Summary May regulate certain MYC target genes, MYC seems to be a direct upstream transcriptional activator. Does not seem to significantly affect growth cell capacity. Overexpression seems to mediate many of the known phenotypic features associated with MYC, including promotion of apoptosis, alteration of morphology, enhancement of anchorage-independent growth, tumorigenic conversion, promotion of genomic instability, and inhibition of hematopoietic differentiation (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:MYCT1 (NM_025107) Human Untagged Clone
Your Rating
SKU Description Size Price
RC220258 MYCT1 (Myc-DDK-tagged)-Human myc target 1 (MycT1) 10 ug
$300.00
RC220258L1 Lenti ORF clone of Human myc target 1 (MYCT1), Myc-DDK-tagged 10 ug
$600.00
RC220258L2 Lenti ORF clone of Human myc target 1 (MYCT1), mGFP tagged 10 ug
$600.00
RC220258L3 Lenti ORF clone of Human myc target 1 (MYCT1), Myc-DDK-tagged 10 ug
$600.00
RC220258L4 Lenti ORF clone of Human myc target 1 (MYCT1), mGFP tagged 10 ug
$600.00
RG220258 MYCT1 (tGFP-tagged) - Human myc target 1 (MYCT1) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.