DBF4B (NM_025104) Human Untagged Clone

SKU SC305234

DBF4B (untagged)-Human DBF4 homolog B (S. cerevisiae) (DBF4B), transcript variant 2

Product Data

• Type: Human Untagged Clone
• Target Symbol: DBF4B
• Synonyms: ASKL1; CHIFB; DRF1; ZDBF1B
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_025104 edited; ATGAGCGAACCGGGAAAGGGAGACGATTGCCTCGAGCTGGAGAGTTCCATGGCTGAGAGT; AGGCTCCGGGCCCCGGACCTAGGAGTTTCCAGGTGTCTAGGAAAATGCCAGAAGAACTCA; CCAGGTGCCAGGAAGCATCCCTTTTCCGGAAAGTCCTTTTACTTGGATCTGCCTGCTGGC; AAGAATCTCCAGTTTTTGACGGGGGCCATTCAGCAACTGGGTGGGGTAATTGAGGGTTTT; CTGAGCAAAGAAGTAAGTTACATCGTGTCCAGCCGCAGAGAAGTAAAGGCAGAGAGCAGT; GGGAAAAGCCATAGAGGCTGCCCTAGCCCTAGCCCCAGTGAGGTCAGAGTGGAAACATCG; GCCATGGTTGATCCAAAAGGCAGCCACCCCAGGCCTTCACGGAAACCCGTTGACTCGGTG; CCTCTAAGCAGAGGGAAGGAGCTGCTGCAGAAGGCTATCAGAAACCAGGTGAGCTGGGGC; AAGATGGGGAGCCGGTGGTCTCCAGCATAG;
• Restriction Sites: Please inquire
• ACCN: NM_025104
• Insert Size: 1800 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_025104.2, NP_079380.1
• RefSeq Size: 2553 bp
• RefSeq ORF: 1821 bp
• Locus ID: 80174
• UniProt ID: Q8NFT6
• Cytogenetics: 17q21
• Summary: This gene encodes a regulator of the cell division cycle 7 homolog (S. cerevisiae) protein, a serine-threonine kinase which links cell cycle regulation to genome duplication. This protein localizes to the nucleus and, in complex with the cell division cycle 7 homolog (S. cerevisiae) protein, may facilitate M phase progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]; Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1.