TAS2R14 (NM_023922) Human Untagged Clone

SKU
SC305084
TAS2R14 (untagged)-Human taste receptor, type 2, member 14 (TAS2R14)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TAS2R14
Synonyms T2R14; TRB1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC305084 representing NM_023922.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGTGGTGTCATAAAGAGCATATTTACATTCGTTTTAATTGTGGAATTTATAATTGGAAATTTAGGA
AATAGTTTCATAGCACTGGTGAACTGTATTGACTGGGTCAAGGGAAGAAAGATCTCTTCGGTTGATCGG
ATCCTCACTGCTTTGGCAATCTCTCGAATTAGCCTGGTTTGGTTAATATTCGGAAGCTGGTGTGTGTCT
GTGTTTTTCCCAGCTTTATTTGCCACTGAAAAAATGTTCAGAATGCTTACTAATATCTGGACAGTGATC
AATCATTTTAGTGTCTGGTTAGCTACAGGCCTCGGTACTTTTTATTTTCTCAAGATAGCCAATTTTTCT
AACTCTATTTTTCTCTACCTAAAGTGGAGGGTTAAAAAGGTGGTTTTGGTGCTGCTTCTTGTGACTTCG
GTCTTCTTGTTTTTAAATATTGCACTGATAAACATCCATATAAATGCCAGTATCAATGGATACAGAAGA
AACAAGACTTGCAGTTCTGATTCAAGTAACTTTACACGATTTTCCAGTCTTATTGTATTAACCAGCACT
GTGTTCATTTTCATACCCTTTACTTTGTCCCTGGCAATGTTTCTTCTCCTCATCTTCTCCATGTGGAAA
CATCGCAAGAAGATGCAGCACACTGTCAAAATATCCGGAGACGCCAGCACCAAAGCCCACAGAGGAGTT
AAAAGTGTGATCACTTTCTTCCTACTCTATGCCATTTTCTCTCTGTCTTTTTTCATATCAGTTTGGACC
TCTGAAAGGTTGGAGGAAAATCTAATTATTCTTTCCCAGGTGATGGGAATGGCTTATCCTTCATGTCAC
TCATGTGTTCTGATTCTTGGAAACAAGAAGCTGAGACAGGCCTCTCTGTCAGTGCTACTGTGGCTGAGG
TACATGTTCAAAGATGGGGAGCCCTCAGGTCACAAAGAATTTAGAGAATCATCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_023922
Insert Size 954 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_023922.1
RefSeq Size 954 bp
RefSeq ORF 954 bp
Locus ID 50840
UniProt ID Q9NYV8
Cytogenetics 12p13.2
Protein Families Transmembrane
Protein Pathways Taste transduction
MW 36.2 kDa
Summary This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:TAS2R14 (NM_023922) Human Untagged Clone
Your Rating
SKU Description Size Price
RC224253 TAS2R14 (Myc-DDK-tagged)-Human taste receptor, type 2, member 14 (TAS2R14) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RC224253L1 Lenti ORF clone of Human taste receptor, type 2, member 14 (TAS2R14), Myc-DDK-tagged 10 ug
$600.00
RC224253L2 Lenti ORF clone of Human taste receptor, type 2, member 14 (TAS2R14), mGFP tagged 10 ug
$600.00
RC224253L3 Lenti ORF clone of Human taste receptor, type 2, member 14 (TAS2R14), Myc-DDK-tagged 10 ug
$600.00
RC224253L4 Lenti ORF clone of Human taste receptor, type 2, member 14 (TAS2R14), mGFP tagged 10 ug
$600.00
RG224253 TAS2R14 (tGFP-tagged) - Human taste receptor, type 2, member 14 (TAS2R14) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.