Cadherin like 26 (CDH26) (NM_021810) Human Untagged Clone

SKU SC304960

CDH26 (untagged)-Human cadherin 26 (CDH26), transcript variant b

Product Data

• Type: Human Untagged Clone
• Target Symbol: Cadherin like 26
• Synonyms: VR20
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_021810, the custom clone sequence may differ by one or more nucleotides; ATGAAACCTCTGATATGGACATGGTCAGATGTTGAAGGCCAGAGGCCGGCTCTGCTCATC; TGCACAGCTGCAGCAGGACCCACGCAGGGAGTTAAGGATCTCGAGGAAGTGCCTCCATCT; GCAGCGAGTCAGTCAGCCCAAGCACGCTGTGCTCTGGGGAGCTGGGGTTATGGCAAGCCC; TTTGAGCCAAGAAGTGTGAAAAACATACACTCTACTCCTGCTTACCCAGATGCCACAATG; CACAGACAACTCCTGGCTCCGGTGGAAGGAAGGATGGCAGAGACATTGAATCAGAAACTC; CATGTTGCCAATGTGCTGGAAGATGACCCCGGCTACCTACCTCACGTCTACAGCGAGGAA; GGGGAGTGTGGAGGGGCCCCATCCCTCAGCTCTCTGGCCAGCTTGGAACAGGAGTTGCAA; CCTGATTTGCTGGACTCTTTGGGTTCAAAAGCGACTCCGTTTGAGGAAATATATTCAGAG; TCAGGTGTTCCTTCCTAA;
• Restriction Sites: Please inquire
• ACCN: NM_021810
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_021810.3, NP_068582.2
• RefSeq Size: 1078 bp
• RefSeq ORF: 498 bp
• Locus ID: 60437
• UniProt ID: Q8IXH8
• Cytogenetics: 20q13.33
• Protein Families: Transmembrane
• Summary: This gene encodes a member of the cadherin protein family. Cadherins are a family of calcium-dependent adhesion molecules that mediate cell-cell adhesion in all solid tissues and modulate a wide variety of processes, including cell polarization, migration and differentiation. Cadherin domains occur as repeats in the extracellular region and are thought to contribute to the sorting of heterogeneous cell types and the maintenance of orderly structures such as epithelium. This protein is expressed in gastrointestinal epithelial cells and may be upregulated during allergic inflammation. This protein interacts with alpha integrins and may also be involved in leukocyte migration and adhesion. [provided by RefSeq, Jan 2017]; Transcript Variant: This variant (b) use an alternate exon in the 5' UTR and 5' coding region and lacks a large portion of the 5' coding region, compared to variant a. The encoded isoform (b) has a a shorter and distinct N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.