MAGEA5 (NM_021049) Human Untagged Clone

SKU SC304898

MAGEA5 (untagged)-Human melanoma antigen family A, 5 (MAGEA5)

Product Data

• Type: Human Untagged Clone
• Target Symbol: MAGEA5
• Synonyms: CT1.5; MAGE5; MAGEA4
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_021049 edited; ATGTCTCTTGAGCAGAAGAGTCAGCACTGCAAGCCTGAGGAAGGCCTTGACACCCAAGAA; GAGGCCCTGGGCCTGGTGGGTGTGCAGGCTGCCACTACTGAGGAGCAGGAGGCTGTGTCC; TCCTCCTCTCCTCTGGTCCCAGGCACCCTGGGGGAGGTGCCTGCTGCTGGGTCACCAGGT; CCTCTCAAGAGTCCTCAGGGAGCCTCCGCCATCCCCACTGCCATCGATTTCACTCTATGG; AGGCAATCCATTAAGGGCTCCAGCAACCAAGAAGAGGAGGGGCCAAGCACCTCCCCTGAC; CCAGAGTCTGTGTTCCGAGCAGCACTCAGTAAGAAGGTGGCTGACTTGATTCATTTTCTG; CTCCTCAAGTATTAA;
• Restriction Sites: Please inquire
• ACCN: NM_021049
• Insert Size: 375 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced, and found to be a perfect match to the published NM_021049.3.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_021049.3, NP_066387.1
• RefSeq Size: 1692 bp
• RefSeq ORF: 375 bp
• Locus ID: 4104
• UniProt ID: P43359
• Cytogenetics: Xq28
• Summary: This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. This MAGEA gene is interpreted to be a pseudogene. Read-through transcription exists between this gene and the upstream melanoma antigen family A, 10 (MAGEA10) gene. [provided by RefSeq, Dec 2020]