ABO (NM_020469) Human Untagged Clone
SKU
SC304773
ABO (untagged)-Human ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase, transferase B, alpha 1-3-galactosyltransferase) (ABO)
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | ABO |
Synonyms | A3GALNT; A3GALT1; GTB; NAGAT |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC304773 representing NM_020469.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCGAGGTGTTGCGGACGCTGGCCGGAAAACCAAAATGCCACGCACTTCGACCTATGATCCTTTTC CTAATAATGCTTGTCTTGGTCTTGTTTGGTTACGGGGTCCTAAGCCCCAGAAGTCTAATGCCAGGAAGC CTGGAACGGGGGTTCTGCATGGCTGTTAGGGAACCTGACCATCTGCAGCGCGTCTCGTTGCCAAGGATG GTCTACCCCCAGCCAAAGGTGCTGACACCGTGTAGGAAGGATGTCCTCGTGGTGACCCCTTGGCTGGCT CCCATTGTCTGGGAGGGCACATTCAACATCGACATCCTCAACGAGCAGTTCAGGCTCCAGAACACCACC ATTGGGTTAACTGTGTTTGCCATCAAGAAATACGTGGCTTTCCTGAAGCTGTTCCTGGAGACGGCGGAG AAGCACTTCATGGTGGGCCACCGTGTCCACTACTATGTCTTCACCGACCAGCCGGCCGCGGTGCCCCGC GTGACGCTGGGGACCGGTCGGCAGCTGTCAGTGCTGGAGGTGCGCGCCTACAAGCGCTGGCAGGACGTG TCCATGCGCCGCATGGAGATGATCAGTGACTTCTGCGAGCGGCGCTTCCTCAGCGAGGTGGATTACCTG GTGTGCGTGGACGTGGACATGGAGTTCCGCGACCACGTGGGCGTGGAGATCCTGACTCCGCTGTTCGGC ACCCTGCACCCCGGCTTCTACGGAAGCAGCCGGGAGGCCTTCACCTACGAGCGCCGGCCCCAGTCCCAG GCCTACATCCCCAAGGACGAGGGCGATTTCTACTACCTGGGGGGGTTCTTCGGGGGGTCGGTGCAAGAG GTGCAGCGGCTCACCAGGGCCTGCCACCAGGCCATGATGGTCGACCAGGCCAACGGCATCGAGGCCGTG TGGCACGACGAGAGCCACCTGAACAAGTACCTGCTGCGCCACAAACCCACCAAGGTGCTCTCCCCCGAG TACTTGTGGGACCAGCAGCTGCTGGGCTGGCCCGCCGTCCTGAGGAAGCTGAGGTTCACTGCGGTGCCC AAGAACCACCAGGCGGTCCGGAACCCGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_020469 |
Insert Size | 1065 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_020469.2 |
RefSeq Size | 1580 bp |
RefSeq ORF | 1065 bp |
Locus ID | 28 |
UniProt ID | P16442 |
Cytogenetics | 9q34.2 |
Protein Families | Secreted Protein, Transmembrane |
Protein Pathways | Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways |
MW | 40.9 kDa |
Summary | This gene encodes proteins related to the first discovered blood group system, ABO. Variation in the ABO gene (chromosome 9q34.2) is the basis of the ABO blood group, thus the presence of an allele determines the blood group in an individual. The 'O' blood group is caused by a deletion of guanine-258 near the N-terminus of the protein which results in a frameshift and translation of an almost entirely different protein. Individuals with the A, B, and AB alleles express glycosyltransferase activities that convert the H antigen into the A or B antigen. Other minor alleles have been found for this gene. This locus has been identified as a susceptibility locus for severe coronavirus disease 2019 (COVID-19) by genome-wide association study. [provided by RefSeq, Aug 2020] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC210203 | ABO (Myc-DDK-tagged)-Human ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase, transferase B, alpha 1-3-galactosyltransferase) (ABO) | 10 ug |
$457.00
|
|
RC210203L1 | Lenti ORF clone of Human ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase) (ABO), Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC210203L2 | Lenti ORF clone of Human ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase) (ABO), mGFP tagged | 10 ug |
$757.00
|
|
RC210203L3 | Lenti ORF clone of Human ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase) (ABO), Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC210203L4 | Lenti ORF clone of Human ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase) (ABO), mGFP tagged | 10 ug |
$757.00
|
|
RG210203 | ABO (tGFP-tagged) - Human ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase) (ABO) | 10 ug |
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.