Otoraplin (OTOR) (NM_020157) Human Untagged Clone

SKU
SC304714
OTOR (untagged)-Human otoraplin (OTOR)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Otoraplin
Synonyms FDP; MIAL1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC304714 representing NM_020157.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAAGAATATTGTTACTTTTCCTCCCGGGTCTTGTGGCTGTATGTGCTGTGCATGGAATATTTATG
GACCGTCTAGCTTCCAAGAAGCTCTGTGCAGATGATGAGTGTGTCTATACTATTTCTCTGGCTAGTGCT
CAAGAAGATTATAATGCCCCGGACTGTAGATTCATTAACGTTAAAAAAGGGCAGCAGATCTATGTGTAC
TCAAAGCTGGTAAAAGAAAATGGAGCTGGAGAATTTTGGGCTGGCAGTGTTTATGGTGATGGCCAGGAC
GAGATGGGAGTCGTGGGTTATTTCCCCAGGAACTTGGTCAAGGAACAGCGTGTGTACCAGGAAGCTACC
AAGGAAGTTCCCACCACGGATATTGACTTCTTCTGCGAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_020157
Insert Size 387 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_020157.3
RefSeq Size 1482 bp
RefSeq ORF 387 bp
Locus ID 56914
UniProt ID Q9NRC9
Cytogenetics 20p12.1
Protein Families Secreted Protein, Transmembrane
MW 14.3 kDa
Summary This gene encodes a member of the melanoma-inhibiting activity gene family. The encoded protein is secreted via the Golgi apparatus and may function in cartilage development and maintenance. A frequent polymorphism in the translation start codon of this gene can abolish translation and may be associated with forms of deafness. [provided by RefSeq, Jul 2013]
Write Your Own Review
You're reviewing:Otoraplin (OTOR) (NM_020157) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210984 OTOR (Myc-DDK-tagged)-Human otoraplin (OTOR) 10 ug
$150.00
RC210984L3 Lenti ORF clone of Human otoraplin (OTOR), Myc-DDK-tagged 10 ug
$450.00
RC210984L4 Lenti ORF clone of Human otoraplin (OTOR), mGFP tagged 10 ug
$450.00
RG210984 OTOR (tGFP-tagged) - Human otoraplin (OTOR) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.