IL36 gamma (IL36G) (NM_019618) Human Untagged Clone

CAT#: SC304685

IL36G (untagged)-Human interleukin 1 family, member 9 (IL1F9)


  "NM_019618" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
IL1F9 (IL36 gamma) mouse monoclonal antibody, clone OTI2F4 (formerly 2F4)
    • 100 ul

USD 478.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "IL36 gamma"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IL36 gamma
Synonyms IL-1F9; IL-1H1; IL-1RP2; IL1E; IL1F9; IL1H1; IL1RP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_019618 edited
ATGAGAGGCACTCCAGGAGACGCTGATGGTGGAGGAAGGGCCGTCTATCAATCAATGTGT
AAACCTATTACTGGGACTATTAATGATTTGAATCAGCAAGTGTGGACCCTTCAGGGTCAG
AACCTTGTGGCAGTTCCACGAAGTGACAGTGTGACCCCAGTCACTGTTGCTGTTATCACA
TGCAAGTATCCAGAGGCTCTTGAGCAAGGCAGAGGGGATCCCATTTATTTGGGAATCCAG
AATCCAGAAATGTGTTTGTATTGTGAGAAGGTTGGAGAACAGCCCACATTGCAGCTAAAA
GAGCAGAAGATCATGGATCTGTATGGCCAACCCGAGCCCGTGAAACCCTTCCTTTTCTAC
CGTGCCAAGACTGGTAGGACCTCCACCCTTGAGTCTGTGGCCTTCCCGGACTGGTTCATT
GCCTCCTCCAAGAGAGACCAGCCCATCATTCTGACTTCAGAACTTGGGAAGTCATACAAC
ACTGCCTTTGAATTAAATATAAATGACTGA
Restriction Sites Please inquire     
ACCN NM_019618
Insert Size 500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_019618.2, NP_062564.1
RefSeq Size 1180 bp
RefSeq ORF 510 bp
Locus ID 56300
UniProt ID Q9NZH8
Cytogenetics 2q14.1
Protein Families Druggable Genome, Secreted Protein
Gene Summary The protein encoded by this gene is a member of the interleukin 1 cytokine family. The activity of this cytokine is mediated by interleukin 1 receptor-like 2 (IL1RL2/IL1R-rp2), and is specifically inhibited by interleukin 1 family, member 5 (IL1F5/IL-1 delta). Interferon-gamma, tumor necrosis factor-alpha and interleukin 1, beta (IL1B) are reported to stimulate the expression of this cytokine in keratinocytes. The expression of this cytokine in keratinocytes can also be induced by a contact hypersensitivity reaction or herpes simplex virus infection. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. [provided by RefSeq, May 2019]
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.