IL36 gamma (IL36G) (NM_019618) Human Untagged Clone

SKU SC304685

IL36G (untagged)-Human interleukin 1 family, member 9 (IL1F9)

Product Data

• Type: Human Untagged Clone
• Target Symbol: IL36 gamma
• Synonyms: IL-1F9; IL-1H1; IL-1RP2; IL1E; IL1F9; IL1H1; IL1RP2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_019618 edited; ATGAGAGGCACTCCAGGAGACGCTGATGGTGGAGGAAGGGCCGTCTATCAATCAATGTGT; AAACCTATTACTGGGACTATTAATGATTTGAATCAGCAAGTGTGGACCCTTCAGGGTCAG; AACCTTGTGGCAGTTCCACGAAGTGACAGTGTGACCCCAGTCACTGTTGCTGTTATCACA; TGCAAGTATCCAGAGGCTCTTGAGCAAGGCAGAGGGGATCCCATTTATTTGGGAATCCAG; AATCCAGAAATGTGTTTGTATTGTGAGAAGGTTGGAGAACAGCCCACATTGCAGCTAAAA; GAGCAGAAGATCATGGATCTGTATGGCCAACCCGAGCCCGTGAAACCCTTCCTTTTCTAC; CGTGCCAAGACTGGTAGGACCTCCACCCTTGAGTCTGTGGCCTTCCCGGACTGGTTCATT; GCCTCCTCCAAGAGAGACCAGCCCATCATTCTGACTTCAGAACTTGGGAAGTCATACAAC; ACTGCCTTTGAATTAAATATAAATGACTGA;
• Restriction Sites: Please inquire
• ACCN: NM_019618
• Insert Size: 500 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_019618.2, NP_062564.1
• RefSeq Size: 1180 bp
• RefSeq ORF: 510 bp
• Locus ID: 56300
• UniProt ID: Q9NZH8
• Cytogenetics: 2q14.1
• Protein Families: Druggable Genome, Secreted Protein
• Summary: The protein encoded by this gene is a member of the interleukin 1 cytokine family. The activity of this cytokine is mediated by interleukin 1 receptor-like 2 (IL1RL2/IL1R-rp2), and is specifically inhibited by interleukin 1 family, member 5 (IL1F5/IL-1 delta). Interferon-gamma, tumor necrosis factor-alpha and interleukin 1, beta (IL1B) are reported to stimulate the expression of this cytokine in keratinocytes. The expression of this cytokine in keratinocytes can also be induced by a contact hypersensitivity reaction or herpes simplex virus infection. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. [provided by RefSeq, May 2019]; Transcript Variant: This variant (1) encodes the longer isoform (1).