beta Defensin 3 (DEFB103B) (NM_018661) Human Untagged Clone

SKU
SC304620
DEFB103B (untagged)-Human defensin, beta 103B (DEFB103B)
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol beta Defensin 3
Synonyms BD-3; DEFB-3; DEFB3; DEFB103; HBD-3; HBD3; HBP-3; HBP3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_018661 edited
ATGAGGATCCATTATCTTCTGTTTGCTTTGCTCTTCCTGTTTTTGGTGCCTGTTCCAGGT
CATGGAGGAATCATAAACACATTACAGAAATATTATTGCAGAGTCAGAGGCGGCCGGTGT
GCTGTGCTCAGCTGCCTTCCAAAGGAGGAACAGATCGGCAAGTGCTCGACGCGTGGCCGA
AAATGCTGCCGAAGAAAGAAATAA
Restriction Sites Please inquire
ACCN NM_018661
Insert Size 200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_018661.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_018661.2, NP_061131.1
RefSeq Size 523 bp
RefSeq ORF 204 bp
Locus ID 55894
UniProt ID P81534
Cytogenetics 8p23.1
Protein Families Secreted Protein, Transmembrane
Summary Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Members of the defensin family are highly similar in protein sequence. This gene encodes defensin, beta 103, which has broad spectrum antimicrobial activity and may play an important role in innate epithelial defense. [provided by RefSeq, Oct 2014]
Write Your Own Review
You're reviewing:beta Defensin 3 (DEFB103B) (NM_018661) Human Untagged Clone
Your Rating
SKU Description Size Price
RC223222 DEFB103B (Myc-DDK-tagged)-Human defensin, beta 103B (DEFB103B) 10 ug
$150.00
RC223222L1 Lenti ORF clone of Human defensin, beta 103B (DEFB103B), Myc-DDK-tagged 10 ug
$450.00
RC223222L2 Lenti ORF clone of Human defensin, beta 103B (DEFB103B), mGFP tagged 10 ug
$450.00
RC223222L3 Lenti ORF clone of Human defensin, beta 103B (DEFB103B), Myc-DDK-tagged 10 ug
$450.00
RC223222L4 Lenti ORF clone of Human defensin, beta 103B (DEFB103B), mGFP tagged 10 ug
$450.00
RG223222 DEFB103B (tGFP-tagged) - Human defensin, beta 103B (DEFB103B) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.