TAS2R16 (NM_016945) Human Untagged Clone

SKU
SC304456
TAS2R16 (untagged)-Human taste receptor, type 2, member 16 (TAS2R16)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TAS2R16
Synonyms BGLPT; T2R16
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC304456 representing NM_016945.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATACCCATCCAACTCACTGTCTTCTTCATGATCATCTATGTGCTTGAGTCCTTGACAATTATTGTG
CAGAGCAGCCTAATTGTTGCAGTGCTGGGCAGAGAATGGCTGCAAGTCAGAAGGCTGATGCCTGTGGAC
ATGATTCTCATCAGCCTGGGCATCTCTCGCTTCTGTCTACAGTGGGCATCAATGCTGAACAATTTTTGC
TCCTATTTTAATTTGAATTATGTACTTTGCAACTTAACAATCACCTGGGAATTTTTTAATATCCTTACA
TTCTGGTTAAACAGCTTGCTTACCGTGTTCTACTGCATCAAGGTCTCTTCTTTCACCCATCACATCTTT
CTCTGGCTGAGGTGGAGAATTTTGAGGTTGTTTCCCTGGATATTACTGGGTTCTCTGATGATTACTTGT
GTAACAATCATCCCTTCAGCTATTGGGAATTACATTCAAATTCAGTTACTCACCATGGAGCATCTACCA
AGAAACAGCACTGTAACTGACAAACTTGAAAATTTTCATCAGTATCAGTTCCAGGCTCATACAGTTGCA
TTGGTTATTCCTTTCATCCTGTTCCTGGCCTCCACCATCTTTCTCATGGCATCACTGACCAAGCAGATA
CAACATCATAGCACTGGTCACTGCAATCCAAGCATGAAAGCGCGCTTCACTGCCCTGAGGTCCCTTGCC
GTCTTATTTATTGTGTTTACCTCTTACTTTCTAACCATACTCATCACCATTATAGGTACTCTATTTGAT
AAGAGATGTTGGTTATGGGTCTGGGAAGCTTTTGTCTATGCTTTCATCTTAATGCATTCCACTTCACTG
ATGCTGAGCAGCCCTACGTTGAAAAGGATTCTAAAGGGAAAGTGCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_016945
Insert Size 876 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016945.2
RefSeq Size 996 bp
RefSeq ORF 876 bp
Locus ID 50833
UniProt ID Q9NYV7
Cytogenetics 7q31
Protein Families Druggable Genome, Transmembrane
Protein Pathways Taste transduction
MW 34 kDa
Summary This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily. These family members are specifically expressed by taste receptor cells of the tongue and palate epithelia. Each of these apparently intronless genes encodes a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered with another 3 candidate taste receptor genes in chromosome 7 and is genetically linked to loci that influence bitter perception. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:TAS2R16 (NM_016945) Human Untagged Clone
Your Rating
SKU Description Size Price
RC222288 TAS2R16 (Myc-DDK-tagged)-Human taste receptor, type 2, member 16 (TAS2R16) 10 ug
$300.00
RC222288L3 Lenti ORF clone of Human taste receptor, type 2, member 16 (TAS2R16), Myc-DDK-tagged 10 ug
$600.00
RC222288L4 Lenti ORF clone of Human taste receptor, type 2, member 16 (TAS2R16), mGFP tagged 10 ug
$600.00
RG222288 TAS2R16 (tGFP-tagged) - Human taste receptor, type 2, member 16 (TAS2R16) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.