PPIL1 (NM_016059) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | PPIL1 |
Synonyms | CGI-124; CYPL1; hCyPX; PCH14; PPIase |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC304377 representing NM_016059.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCAATTCCCCCAGATTCCTGGCAGCCACCCAACGTTTACTTGGAGACCAGCATGGGAATCATT GTGCTGGAGCTGTACTGGAAGCATGCTCCAAAGACCTGTAAGAACTTTGCTGAGTTGGCTCGTCGAGGT TACTACAATGGCACAAAATTCCACAGAATTATCAAAGACTTCATGATCCAAGGAGGTGACCCAACAGGG ACAGGTCGAGGTGGTGCATCTATCTATGGCAAACAGTTTGAAGATGAACTTCATCCAGACTTGAAATTC ACGGGGGCTGGAATTCTCGCAATGGCCAATGCGGGGCCAGATACCAATGGCAGCCAGTTCTTTGTGACC CTCGCCCCCACCCAGTGGCTTGACGGCAAACACACCATTTTTGGCCGAGTGTGTCAGGGCATAGGAATG GTGAATCGCGTGGGAATGGTAGAAACAAACTCCCAGGACCGCCCTGTGGACGACGTGAAGATCATTAAG GCATACCCTTCTGGGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_016059 |
Insert Size | 501 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_016059.4 |
RefSeq Size | 1750 bp |
RefSeq ORF | 501 bp |
Locus ID | 51645 |
UniProt ID | Q9Y3C6 |
Cytogenetics | 6p21.2 |
Protein Pathways | Spliceosome |
MW | 18.2 kDa |
Summary | This gene is a member of the cyclophilin family of peptidylprolyl isomerases (PPIases). The cyclophilins are a highly conserved, ubiquitous family, members of which play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. Based on similarity to other PPIases, this protein could accelerate the folding of proteins and might catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. [provided by RefSeq, Jul 2008] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC200015 | PPIL1 (Myc-DDK-tagged)-Human peptidylprolyl isomerase (cyclophilin)-like 1 (PPIL1) | 10 ug |
$150.00
|
|
RC200015L3 | Lenti ORF clone of Human peptidylprolyl isomerase (cyclophilin)-like 1 (PPIL1), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC200015L4 | Lenti ORF clone of Human peptidylprolyl isomerase (cyclophilin)-like 1 (PPIL1), mGFP tagged | 10 ug |
$450.00
|
|
RG200015 | PPIL1 (tGFP-tagged) - Human peptidylprolyl isomerase (cyclophilin)-like 1 (PPIL1) | 10 ug |
$489.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.