TMEM41B (NM_015012) Human Untagged Clone

SKU
SC304205
TMEM41B (untagged)-Human transmembrane protein 41B (TMEM41B), transcript variant 1
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TMEM41B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC304205 representing NM_015012.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGAAAGGCAGAGTCGCCGAACGATCGCAGTTGGGCGCTCACCACACGACCCCCGTGGGGGACGGG
GCAGCGGGGACGCGGGGTCTCGCGGCGCCTGGCAGCAGAGACCACCAGAAGGAAAAATCCTGGGTAGAA
GCTGGATCAGCAAGAATGTCACTCCTTATATTGGTGTCCATTTTCTTATCTGCAGCTTTTGTTATGTTT
TTGGTATATAAAAATTTTCCTCAGCTTAGTGAAGAAGAAAGAGTGAATATGAAGGTTCCCAGAGATATG
GATGATGCCAAGGCTCTAGGAAAAGTTTTATCCAAATACAAGGACACCTTTTATGTTCAAGTACTTGTA
GCTTATTTTGCTACATATATTTTCTTGCAAACATTTGCTATTCCAGGCTCTATATTTCTCAGTATACTC
TCAGGGTTTCTTTATCCCTTTCCACTAGCCTTATTTCTTGTTTGTTTGTGTTCTGGACTTGGTGCCTCT
TTCTGTTATATGCTTTCCTATTTAGTTGGGAGACCAGTTGTATACAAATACCTAACAGAGAAAGCAGTA
AAATGGTCACAGCAGGTTGAACGTCATAGAGAACATCTCATTAACTACATTATATTTTTGAGAATAACA
CCATTTCTGCCTAATTGGTTTATTAATATCACATCTCCTGTGATAAACGTGCCATTGAAAGTTTTTTTT
ATTGGTACTTTTCTAGGTGTCGCACCTCCTTCTTTTGTAGCCATTAAGGCAGGAACAACACTGTATCAA
CTTACAACAGCAGGAGAAGCTGTTTCCTGGAACTCAATATTTATTCTGATGATCTTGGCTGTTCTTTCT
ATTCTGCCAGCCATCTTCCAAAAAAAACTAAAGCAGAAATTTGAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_015012
Insert Size 876 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_015012.3
RefSeq Size 3973 bp
RefSeq ORF 876 bp
Locus ID 440026
UniProt ID Q5BJD5
Cytogenetics 11p15.4
Protein Families Transmembrane
MW 32.5 kDa
Summary Required for normal motor neuron development (By similarity). Required for autophagosome formation (PubMed:30093494).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:TMEM41B (NM_015012) Human Untagged Clone
Your Rating
SKU Description Size Price
RC216351 TMEM41B (Myc-DDK-tagged)-Human transmembrane protein 41B (TMEM41B), transcript variant 1 10 ug
$300.00
RC216351L3 Lenti ORF clone of Human transmembrane protein 41B (TMEM41B), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC216351L4 Lenti ORF clone of Human transmembrane protein 41B (TMEM41B), transcript variant 1, mGFP tagged 10 ug
$600.00
RG216351 TMEM41B (tGFP-tagged) - Human transmembrane protein 41B (TMEM41B), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.