IL36 alpha (IL36A) (NM_014440) Human Untagged Clone

SKU
SC304107
IL36A (untagged)-Human interleukin 1 family, member 6 (epsilon) (IL1F6)
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol IL36 alpha
Synonyms FIL1; FIL1(EPSILON); FIL1E; IL-1F6; IL1(EPSILON); IL1F6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_014440, the custom clone sequence may differ by one or more nucleotides


ATGGAAAAAGCATTGAAAATTGACACACCTCAGCAGGGGAGCATTCAGGATATCAATCATCGGGTGTGGG
TTCTTCAGGACCAGACGCTCATAGCAGTCCCGAGGAAGGACCGTATGTCTCCAGTCACTATTGCCTTAAT
CTCATGCCGACATGTGGAGACCCTTGAGAAAGACAGAGGGAACCCCATCTACCTGGGCCTGAATGGACTC
AATCTCTGCCTGATGTGTGCTAAAGTCGGGGACCAGCCCACACTGCAGCTGAAGGAAAAGGATATAATGG
ATTTGTACAACCAACCCGAGCCTGTGAAGTCCTTTCTCTTCTACCACAGCCAGAGTGGCAGGAACTCCAC
CTTCGAGTCTGTGGCTTTCCCTGGCTGGTTCATCGCTGTCAGCTCTGAAGGAGGCTGTCCTCTCATCCTT
ACCCAAGAACTGGGGAAAGCCAACACTACTGACTTTGGGTTAACTATGCTGTTTTAA


Restriction Sites Please inquire
ACCN NM_014440
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014440.1, NP_055255.1
RefSeq Size 477 bp
RefSeq ORF 477 bp
Locus ID 27179
UniProt ID Q9UHA7
Cytogenetics 2q14.1
Protein Families Druggable Genome, Secreted Protein
Summary The protein encoded by this gene is a cytokine that can activate NF-kappa-B and MAPK signaling pathways to generate an inflammatory response. The encoded protein functions primarily in skin and demonstrates increased expression in psoriasis. In addition, decreased expression of this gene has been linked to a poor prognosis in both hepatocellular carcinoma and colorectal cancer patients. [provided by RefSeq, Nov 2015]
Write Your Own Review
You're reviewing:IL36 alpha (IL36A) (NM_014440) Human Untagged Clone
Your Rating
SKU Description Size Price
RC219328 IL36A (Myc-DDK-tagged)-Human interleukin 1 family, member 6 (epsilon) (IL1F6) 10 ug
$150.00
RC219328L3 Lenti ORF clone of Human interleukin 1 family, member 6 (epsilon) (IL1F6), Myc-DDK-tagged 10 ug
$450.00
RC219328L4 Lenti ORF clone of Human interleukin 1 family, member 6 (epsilon) (IL1F6), mGFP tagged 10 ug
$450.00
RG219328 IL36A (tGFP-tagged) - Human interleukin 1 family, member 6 (epsilon) (IL1F6) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.