IL19 (NM_013371) Human Untagged Clone

SKU
SC304003
IL19 (untagged)-Human interleukin 19 (IL19), transcript variant 2
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol IL19
Synonyms IL-10C; MDA1; NG.1; ZMDA1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_013371 edited
ATTTCCTCTTATCCACCTGAATAAAAATGACCAGCCCTTTCCAAATGGCAGAGAGCACTG
AGAGGAGACACAAGGAGCAGCCCGCAAGCACCAAGTGAGAGGCATGAAGTTACAGTGTGT
TTCCCTTTGGCTCCTGGGTACAATACTGATATTGTGCTCAGTAGACAACCACGGTCTCAG
GAGATGTCTGATTTCCACAGACATGCACCATATAGAAGAGAGTTTCCAAGAAATCAAAAG
AGCCATCCAAGCTAAGGACACCTTCCCAAATGTCACTATCCTGTCCACATTGGAGACTCT
GCAGATCATTAAGCCCTTAGATGTGTGCTGCGTGACCAAGAACCTCCTGGCGTTCTACGT
GGACAGGGTGTTCAAGGATCATCAGGAGCCAAACCCCAAAATCTTGAGAAAAATCAGCAG
CATTGCCAACTCTTTCCTCTACATGCAGAAAACTCTGCGGCAATGTCAGGAACAGAGGCA
GTGTCACTGCAGGCAGGAAGCCACCAATGCCACCAGAGTCATCCATGACAACTATGATCA
GCTGGAGGTCCACGCTGCTGCCATTAAATCCCTGGGAGAGCTCGACGTCTTTCTAGCCTG
GATTAATAAGAATCATGAAGTAATGTTCTCAGCTTGATGACAAGGAACCTGTATAGTGAT
CCAGGGATGAACACCCCCTGTGCGGTTTACTGTGGGAGACAGCCCAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_013371 unedited
NAGGTCACATTTGTATACGACTCATATAGGGCGGCCGCGATTCAAATCTGGTACCGAGCT
CGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTAGCATTTCCTCTTATC
CACCTGAATAAAAATGACCAGCCCTTTCCAAATGGCAGAGAGCACTGAGAGGAGACACAA
GGAGCAGCCCGCAAGCACCAAGTGAGAGGCATGAAGTTACAGTGTGTTTCCCTTTGGCTC
CTGGGTACAATACTGATATTGTGCTCAGTAGACAACCACGGTCTCAGGAGATGTCTGATT
TCCACAGACATGCACCATATAGAAGAGAGTTTCCAAGAAATCAAAAGAGCCATCCAAGCT
AAGGACACCTTCCCAAATGTCACTATCCTGTCCACATTGGAGACTCTGCAGATCATTAAG
CCCTTAGATGTGTGCTGCGTGACCAAGAACCTCCTGGCGTTCTACGTGGACAGGGTGTTC
AAGGATCATCAGGAGCCAAACCCCAAAATCTTGAGAAAAATCAGCAGCATTGCCAACTCT
TTCCTCTACATGCAGAAAACTCTGCGGCAATGTCAGGAACAGAGGCAGTGTCACTGCAGG
CAGGAAGCCACCAATGCCACCAGAGTCATCCATGACAACTATGATCAGCTGGAGGTCCAC
GCTGCTGCCATTAAATCCCTGGGAGAGCTCGACGTCTTTCTAGCCTGGATTAATAAGAAT
CATGAAGTAATGTTCTCAGCTTGATGACAAGGAACCTGTATAGTGATCCAGGGATGAACA
CCCNCTGTGCGGTTTACTGTGGGAGACAGCCCACAGGGGCGAATTCTGCAGATATCCATC
ACACTGGGCGGCCGCTCGACTCTAGATTGCNGGCCGCGTCATAGCTGTTTCCCTGACAC
Restriction Sites Please inquire
ACCN NM_013371
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This construct is a cloned PCR fragment that was fully sequenced. There are no nucleotide differences between the OriGene clone and the NCBI reference ORF.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_013371.2, NP_037503.2
RefSeq Size 1831 bp
RefSeq ORF 534 bp
Locus ID 29949
UniProt ID Q9UHD0
Cytogenetics 1q32.1
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
Summary The protein encoded by this gene is a cytokine that belongs to the IL10 cytokine subfamily. This cytokine is found to be preferentially expressed in monocytes. It can bind the IL20 receptor complex and lead to the activation of the signal transducer and activator of transcription 3 (STAT3). A similar cytokine in mouse is reported to up-regulate the expression of IL6 and TNF-alpha and induce apoptosis, which suggests a role of this cytokine in inflammatory responses. Alternatively spliced transcript variants encoding the distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) contains two alternate 5' non-coding exons, resulting in translation initiation from an in-frame downstream AUG start codon compared to variant 1. The resulting isoform (2) has a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:IL19 (NM_013371) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212571 IL19 (Myc-DDK-tagged)-Human interleukin 19 (IL19), transcript variant 2 10 ug
$300.00
RC212571L1 Lenti ORF clone of Human interleukin 19 (IL19), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC212571L2 Lenti ORF clone of Human interleukin 19 (IL19), transcript variant 2, mGFP tagged 10 ug
$600.00
RC212571L3 Lenti ORF clone of Human interleukin 19 (IL19), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC212571L4 Lenti ORF clone of Human interleukin 19 (IL19), transcript variant 2, mGFP tagged 10 ug
$600.00
RG212571 IL19 (tGFP-tagged) - Human interleukin 19 (IL19), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.