IL17C (NM_013278) Human Untagged Clone

SKU
SC303993
IL17C (untagged)-Human interleukin 17C (IL17C)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol IL17C
Synonyms CX2; IL-17C
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC303993 representing NM_013278.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACGCTCCTCCCCGGCCTCCTGTTTCTGACCTGGCTGCACACATGCCTGGCCCACCATGACCCCTCC
CTCAGGGGGCACCCCCACAGTCACGGTACCCCACACTGCTACTCGGCTGAGGAACTGCCCCTCGGCCAG
GCCCCCCCACACCTGCTGGCTCGAGGTGCCAAGTGGGGGCAGGCTTTGCCTGTAGCCCTGGTGTCCAGC
CTGGAGGCAGCAAGCCACAGGGGGAGGCACGAGAGGCCCTCAGCTACGACCCAGTGCCCGGTGCTGCGG
CCGGAGGAGGTGTTGGAGGCAGACACCCACCAGCGCTCCATCTCACCCTGGAGATACCGTGTGGACACG
GATGAGGACCGCTATCCACAGAAGCTGGCCTTCGCCGAGTGCCTGTGCAGAGGCTGTATCGATGCACGG
ACGGGCCGCGAGACAGCTGCGCTCAACTCCGTGCGGCTGCTCCAGAGCCTGCTGGTGCTGCGCCGCCGG
CCCTGCTCCCGCGACGGCTCGGGGCTCCCCACACCTGGGGCCTTTGCCTTCCACACCGAGTTCATCCAC
GTCCCCGTCGGCTGCACCTGCGTGCTGCCCCGTTCAGTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_013278
Insert Size 594 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_013278.3
RefSeq Size 1048 bp
RefSeq ORF 594 bp
Locus ID 27189
UniProt ID Q9P0M4
Cytogenetics 16q24.2
Protein Families Druggable Genome, Secreted Protein
MW 21.8 kDa
Summary The protein encoded by this gene is a T cell-derived cytokine that shares the sequence similarity with IL17. This cytokine was reported to stimulate the release of tumor necrosis factor alpha and interleukin 1 beta from a monocytic cell line. The expression of this cytokine was found to be restricted to activated T cells. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:IL17C (NM_013278) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211039 IL17C (Myc-DDK-tagged)-Human interleukin 17C (IL17C) 10 ug
$300.00
RC211039L1 Lenti ORF clone of Human interleukin 17C (IL17C), Myc-DDK-tagged 10 ug
$600.00
RC211039L2 Lenti ORF clone of Human interleukin 17C (IL17C), mGFP tagged 10 ug
$600.00
RC211039L3 Lenti ORF clone of Human interleukin 17C (IL17C), Myc-DDK-tagged 10 ug
$600.00
RC211039L4 Lenti ORF clone of Human interleukin 17C (IL17C), mGFP tagged 10 ug
$600.00
RG211039 IL17C (tGFP-tagged) - Human interleukin 17C (IL17C) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.