SPO11 (NM_012444) Human Untagged Clone

CAT#: SC303983

SPO11 (untagged)-Human SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae) (SPO11), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SPO11
• Synonyms: CT35; SPATA43; TOPOVIA; TOPVIA
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_012444, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCTTTGCACCTATGGGGCCCGAGGCCTCGTTCTTCGACGTTTTGGACCGACACAGGGAGTCCCTGC
  TGGCTGCCCTGAGGAGAGGTGGCAGGGAGCCCCCAACTGGGGGAAGCCGCCTGGCCTCCAGTTCTGAGGT
  TCTTGCATCTATAGAAAATATTATCCAAGACATAATCACAAGCTTGGCAAGAAATGAAGCACCTGCATTC
  ACGATAGACAACAGATCAAGCTGGGAAAACATAAAGTTTGAAGATTCTGTGGGTCTTCAGATGGTATCCC
  ATTGCACCACCAGAAAGATCAAAAGTGATTCACCAAAATCAGCTCAAAAATTTTCTCTAATCCTTAAAAT
  ATTGTCCATGATTTATAAATTAGTACAGAGCAACACTTATGCAACCAAAAGGGACATATATTACACTGAC
  AGTCAACTCTTTGGTAACCAGACTGTCGTCGACAATATTATCAATGACATTTCTTGCATGTTAAAAGTGT
  CAAGGAGGAGTCTACATATATTATCTACATCAAAAGGTTTAATTGCTGGCAACTTAAGATACATCGAGGA
  AGATGGCACCAAAGTGAATTGTACCTGTGGTGCAACGGCTGTTGCTGTGCCATCGAATATTCAAGGAATT
  CGGAATTTAGTTACAGATGCAAAGTTTGTATTAATTGTAGAAAAAGATGCAACATTTCAGCGGCTCCTAG
  ATGACAACTTTTGCAACAAATTGTCTCCTTGCATCATGATTACGGGAAAGGGAGTTCCTGATCTAAACAC
  AAGACTTTTAGTCAAGAAACTGTGGGATACATTTCATGTTCCTGTTTTCACTCTTGTAGATGCTGATCCA
  CATGGCATAGAAATAATGTGCATCTATAAGTATGGATCTATGTCTATGTCTTTTGAAGCTCATCATCTCA
  CAGTTCCAGCTATTAGATGGCTTGGTCTTCTCCCTTCTGATCTTAAAAGATTAAATGTACCTAAAGATAG
  TTTGATTCCACTGACAAAAAGGGACCAAATGAAACTTGACAGTATCCTGAGGAGACCTTATGTTACCTGC
  CAACCATTTTGGAGAAAAGAAATGGAAATAATGGCAGACTCTAAAATGAAGGCAGAAATTCAAGCTTTGA
  CTTTCCTATCATCAGATTATCTTTCCAGAGTGTACTTACCTAACAAATTAAAATTTGGAGGATGGATATA
  A
  
  
• Restriction Sites: Please inquire
• ACCN: NM_012444
• Insert Size: 1800 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_012444.2, NP_036576.1
• RefSeq Size: 1826 bp
• RefSeq ORF: 1191 bp
• Locus ID: 23626
• UniProt ID: Q9Y5K1
• Cytogenetics: 20q13.31
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: Meiotic recombination and chromosome segregation require the formation of double-strand breaks (DSBs) in paired chromosome homologs. During meiosis in yeast, a meiotic recombination protein is covalently-linked to the 5' end of DSBs and is essential for the formation of DSBs. The protein encoded by this gene is similar in sequence and conserved features to the yeast meiotic recombination protein. The encoded protein belongs to the TOP6A protein family. Several transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been described. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).