SPO11 (NM_012444) Human Untagged Clone

SKU
SC303983
SPO11 (untagged)-Human SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae) (SPO11), transcript variant 1
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SPO11
Synonyms CT35; SPATA43; TOPOVIA; TOPVIA
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_012444, the custom clone sequence may differ by one or more nucleotides


ATGGCCTTTGCACCTATGGGGCCCGAGGCCTCGTTCTTCGACGTTTTGGACCGACACAGGGAGTCCCTGC
TGGCTGCCCTGAGGAGAGGTGGCAGGGAGCCCCCAACTGGGGGAAGCCGCCTGGCCTCCAGTTCTGAGGT
TCTTGCATCTATAGAAAATATTATCCAAGACATAATCACAAGCTTGGCAAGAAATGAAGCACCTGCATTC
ACGATAGACAACAGATCAAGCTGGGAAAACATAAAGTTTGAAGATTCTGTGGGTCTTCAGATGGTATCCC
ATTGCACCACCAGAAAGATCAAAAGTGATTCACCAAAATCAGCTCAAAAATTTTCTCTAATCCTTAAAAT
ATTGTCCATGATTTATAAATTAGTACAGAGCAACACTTATGCAACCAAAAGGGACATATATTACACTGAC
AGTCAACTCTTTGGTAACCAGACTGTCGTCGACAATATTATCAATGACATTTCTTGCATGTTAAAAGTGT
CAAGGAGGAGTCTACATATATTATCTACATCAAAAGGTTTAATTGCTGGCAACTTAAGATACATCGAGGA
AGATGGCACCAAAGTGAATTGTACCTGTGGTGCAACGGCTGTTGCTGTGCCATCGAATATTCAAGGAATT
CGGAATTTAGTTACAGATGCAAAGTTTGTATTAATTGTAGAAAAAGATGCAACATTTCAGCGGCTCCTAG
ATGACAACTTTTGCAACAAATTGTCTCCTTGCATCATGATTACGGGAAAGGGAGTTCCTGATCTAAACAC
AAGACTTTTAGTCAAGAAACTGTGGGATACATTTCATGTTCCTGTTTTCACTCTTGTAGATGCTGATCCA
CATGGCATAGAAATAATGTGCATCTATAAGTATGGATCTATGTCTATGTCTTTTGAAGCTCATCATCTCA
CAGTTCCAGCTATTAGATGGCTTGGTCTTCTCCCTTCTGATCTTAAAAGATTAAATGTACCTAAAGATAG
TTTGATTCCACTGACAAAAAGGGACCAAATGAAACTTGACAGTATCCTGAGGAGACCTTATGTTACCTGC
CAACCATTTTGGAGAAAAGAAATGGAAATAATGGCAGACTCTAAAATGAAGGCAGAAATTCAAGCTTTGA
CTTTCCTATCATCAGATTATCTTTCCAGAGTGTACTTACCTAACAAATTAAAATTTGGAGGATGGATATA
A


Restriction Sites Please inquire
ACCN NM_012444
Insert Size 1800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_012444.2, NP_036576.1
RefSeq Size 1826 bp
RefSeq ORF 1191 bp
Locus ID 23626
UniProt ID Q9Y5K1
Cytogenetics 20q13.31
Protein Families Druggable Genome, Transcription Factors
Summary Meiotic recombination and chromosome segregation require the formation of double-strand breaks (DSBs) in paired chromosome homologs. During meiosis in yeast, a meiotic recombination protein is covalently-linked to the 5' end of DSBs and is essential for the formation of DSBs. The protein encoded by this gene is similar in sequence and conserved features to the yeast meiotic recombination protein. The encoded protein belongs to the TOP6A protein family. Several transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).
Write Your Own Review
You're reviewing:SPO11 (NM_012444) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221227 SPO11 (Myc-DDK-tagged)-Human SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae) (SPO11), transcript variant 1 10 ug
$457.00
RC221227L1 Lenti ORF clone of Human SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae) (SPO11), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC221227L2 Lenti ORF clone of Human SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae) (SPO11), transcript variant 1, mGFP tagged 10 ug
$757.00
RC221227L3 Lenti ORF clone of Human SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae) (SPO11), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC221227L4 Lenti ORF clone of Human SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae) (SPO11), transcript variant 1, mGFP tagged 10 ug
$757.00
RG221227 SPO11 (tGFP-tagged) - Human SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae) (SPO11), transcript variant 1 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.