SOX21 (NM_007084) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | SOX21 |
Synonyms | SOX25 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF sequence for NM_007084 edited
ATGTCCAAGCCGGTGGACCACGTCAAGCGGCCCATGAACGCCTTCATGGTGTGGTCGCGG GCTCAGCGGCGCAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAG CGCTTGGGCGCCGAGTGGAAACTGCTCACAGAGTCGGAGAAGCGGCCGTTCATCGACGAG GCCAAGCGTCTACGCGCCATGCACATGAAGGAGCACCCCGACTACAAGTACCGGCCGCGG CGCAAGCCCAAGACGCTGCTCAAGAAGGACAAGTTCGCCTTCCCGGTGCCCTACGGCCTG GGCGGCGTGGCGGACGCCGAGCACCCTGCGCTCAAGGCGGGCGCCGGGCTGCACGCGGGG GCGGGCGGCGGCCTGGTGCCTGAGTCGCTGCTCGCCAATCCCGAGAAGGCGGCCGCGGCC GCCGCCGCTGCCGCCGCACGCGTCTTCTTCCCGCAGTCGGCCGCTGCCGCCGCCGCTGCC GCCGCCGCCGCCGCCGCGGGCAGCCCCTACTCGCTGCTCGACCTGGGCTCCAAAATGGCA GAGATCTCGTCGTCCTCGTCCGGCCTCCCGTACGCGTCGTCGCTGGGCTACCCGACCGCG GGCGCGGGCGCCTTCCACGGCGCGGCGGCGGCGGCTGCAGCGGCGGCCGCCGCCGCCGGG GGGCACACGCACTCGCACCCCAGCCCCGGCAACCCGGGCTACATGATCCCGTGCAACTGC AGCGCGTGGCCCAGCCCCGGGCTGCAGCCGCCGCTCGCCTACATCCTGCTGCCGGGCATG GGCAAGCCCCAGCTGGACCCCTACCCCGCGGCCTACGCTGCCGCGCTATGA |
Restriction Sites | NotI-NotI |
ACCN | NM_007084 |
Insert Size | 2900 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found one SNPs within the protein associated with this reference, NM_007084.2. This SNP doesn't change amino acid. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_007084.2, NP_009015.1 |
RefSeq Size | 2537 bp |
RefSeq ORF | 831 bp |
Locus ID | 11166 |
UniProt ID | Q9Y651 |
Cytogenetics | 13q32.1 |
Summary | SRY-related HMG-box (SOX) genes encode a family of DNA-binding proteins containing a 79-amino acid HMG (high mobility group) domain that shares at least 50% sequence identity with the DNA-binding HMG box of the SRY protein (MIM 480000). SOX proteins are divided into 6 subgroups based on sequence similarity within and outside of the HMG domain. For additional background information on SOX genes, see SOX1 (MIM 602148).[supplied by OMIM, Apr 2004] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC224471 | SOX21 (Myc-DDK-tagged)-Human SRY (sex determining region Y)-box 21 (SOX21) | 10 ug |
$450.00
|
|
RC224471L1 | Lenti-ORF clone of SOX21 (Myc-DDK-tagged)-Human SRY (sex determining region Y)-box 21 (SOX21) | 10 ug |
$750.00
|
|
RC224471L2 | Lenti-ORF clone of SOX21 (mGFP-tagged)-Human SRY (sex determining region Y)-box 21 (SOX21) | 10 ug |
$750.00
|
|
RC224471L3 | Lenti-ORF clone of SOX21 (Myc-DDK-tagged)-Human SRY (sex determining region Y)-box 21 (SOX21) | 10 ug |
$750.00
|
|
RC224471L4 | Lenti-ORF clone of SOX21 (mGFP-tagged)-Human SRY (sex determining region Y)-box 21 (SOX21) | 10 ug |
$750.00
|
|
RG224471 | SOX21 (tGFP-tagged) - Human SRY (sex determining region Y)-box 21 (SOX21) | 10 ug |
$650.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.