CEACAM7 (NM_006890) Human Untagged Clone

SKU
SC303844
CEACAM7 (untagged)-Human carcinoembryonic antigen-related cell adhesion molecule 7 (CEACAM7)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CEACAM7
Synonyms CGM2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_006890 edited
AACACCATGGGTTCCCCTTCAGCCTGTCCATACAGAGTGTGCATTCCCTGGCAGGGGCTC
CTGCTCACAGCCTCGCTTTTAACCTTCTGGAACCTGCCAAACAGTGCCCAGACCAATATT
GATGTCGTGCCGTTCAATGTCGCAGAAGGGAAGGAGGTCCTTCTAGTAGTCCATAATGAG
TCCCAGAATCTTTATGGCTACAACTGGTACAAAGGGGAAAGGGTGCATGCCAACTATCGA
ATTATAGGATATGTAAAAAATATAAGTCAAGAAAATGCCCCAGGGCCCGCACACAACGGT
CGAGAGACAATATACCCCAATGGAACCCTGCTGATCCAGAACGTCACCCACAATGACGCA
GGAATCTATACCCTACACGTTATAAAAGAAAATCTTGTGAATGAAGAAGTAACCAGACAA
TTCTACGTATTCTCGGAGCCACCCAAGCCCTCCATCACCAGCAACAACTTCAATCCGGTG
GAGAACAAAGATATTGTGGTTTTAACCTGTCAACCTGAGACTCAGAACACAACCTACCTG
TGGTGGGTAAACAATCAGAGCCTCCTGGTCAGTCCCAGGCTGCTGCTCTCCACTGACAAC
AGGACCCTCGTTCTACTCAGCGCCACAAAGAATGACATAGGACCCTATGAATGTGAAATA
CAGAACCCAGTGGGTGCCAGCCGCAGTGACCCAGTCACCCTGAATGTCCGCTATGAGTCA
GTACAAGCAAGTTCACCTGACCTCTCAGCTGGGACCGCTGTCAGCATCATGATTGGAGTA
CTGGCTGGGATGGCTCTGATATAGCAGCCTTGGTGTAGTTTCTGCATTTCGGGAAGAGTG
TTTTTATTATCCACCTGCAGACTGGACTGGATTCTTCTAGCTCCTTCAATCCCATTTTCT
CCTGTGGCATCACTAAGTATAAGACCTGCTCTCTTCCTGAAGACCTATAAGCTGGAGGTG
GACAACTCAATGTAAATTTCAAGGAAAAACCCTCATGCCTGAGATGTGGGCCACTCAGAG
CTAACCAAAATGTTCAACACCATAACTAGAGACACTCAAATTGCCAACCAGGACAAGAAG
TTGATGACTTCATGCTGTGGACAGTTTTTCCCAAGATGTCCCAAGCCTCATCGTGACGAG
GCTCTTATCCCACTCCATTTTTCCCTGCTCATGCCTGCCTCTTTAATTTGGTAAGATAAT
GCTGTAACTAGAATTTCACAATCAGCGCCTTGTGCAGGTAATTTGACAGAGTGTTGGATG
TGTCATGTCATCATG
Restriction Sites Please inquire
ACCN NM_006890
Insert Size 1300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to differ from the protein associated to this reference by a single amino acid.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006890.1, NP_008821.1
RefSeq Size 2292 bp
RefSeq ORF 798 bp
Locus ID 1087
UniProt ID Q14002
Cytogenetics 19q13.2
Summary This gene encodes a cell surface glycoprotein and member of the carcinoembryonic antigen (CEA) family of proteins. Expression of this gene may be downregulated in colon and rectal cancer. Additionally, lower expression levels of this gene may be predictive of rectal cancer recurrence. This gene is present in a CEA family gene cluster on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:CEACAM7 (NM_006890) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212214 CEACAM7 (Myc-DDK-tagged)-Human carcinoembryonic antigen-related cell adhesion molecule 7 (CEACAM7) 10 ug
$450.00
RC212214L1 Lenti ORF clone of Human carcinoembryonic antigen-related cell adhesion molecule 7 (CEACAM7), Myc-DDK-tagged 10 ug
$750.00
RC212214L2 Lenti ORF clone of Human carcinoembryonic antigen-related cell adhesion molecule 7 (CEACAM7), mGFP tagged 10 ug
$750.00
RC212214L3 Lenti ORF clone of Human carcinoembryonic antigen-related cell adhesion molecule 7 (CEACAM7), Myc-DDK-tagged 10 ug
$750.00
RC212214L4 Lenti ORF clone of Human carcinoembryonic antigen-related cell adhesion molecule 7 (CEACAM7), mGFP tagged 10 ug
$750.00
RG212214 CEACAM7 (tGFP-tagged) - Human carcinoembryonic antigen-related cell adhesion molecule 7 (CEACAM7) 10 ug
$489.00 MSRP $650.00 MSRP $650.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.