CCL27 (NM_006664) Human Untagged Clone

SKU
SC303807
CCL27 (untagged)-Human chemokine (C-C motif) ligand 27 (CCL27)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CCL27
Synonyms ALP; CTACK; CTAK; ESKINE; ILC; PESKY; SCYA27
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC303807 representing NM_006664.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGGGGCCCCCAACCTTCTGCAGCCTCCTGCTGCTGTCATTGCTCCTGAGCCCAGACCCTACAGCA
GCATTCCTACTGCCACCCAGCACTGCCTGCTGTACTCAGCTCTACCGAAAGCCACTCTCAGACAAGCTA
CTGAGGAAGGTCATCCAGGTGGAACTGCAGGAGGCTGACGGGGACTGTCACCTCCAGGCTTTCGTGCTT
CACCTGGCTCAACGCAGCATCTGCATCCACCCCCAGAACCCCAGCCTGTCACAGTGGTTTGAGCACCAA
GAGAGAAAGCTCCATGGGACTCTGCCCAAGCTGAATTTTGGGATGCTAAGGAAAATGGGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_006664
Insert Size 339 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006664.3
RefSeq Size 475 bp
RefSeq ORF 339 bp
Locus ID 10850
UniProt ID Q9Y4X3
Cytogenetics 9p13.3
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction
MW 12.6 kDa
Summary This gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The protein encoded by this gene is chemotactic for skin-associated memory T lymphocytes. This cytokine may also play a role in mediating homing of lymphocytes to cutaneous sites. It specifically binds to chemokine receptor 10 (CCR10). Studies of a similar murine protein indicate that these protein-receptor interactions have a pivotal role in T cell-mediated skin inflammation. [provided by RefSeq, Sep 2014]
Write Your Own Review
You're reviewing:CCL27 (NM_006664) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221419 CCL27 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 27 (CCL27) 10 ug
$150.00
RC221419L3 Lenti ORF clone of Human chemokine (C-C motif) ligand 27 (CCL27), Myc-DDK-tagged 10 ug
$450.00
RC221419L4 Lenti ORF clone of Human chemokine (C-C motif) ligand 27 (CCL27), mGFP tagged 10 ug
$450.00
RG221419 CCL27 (tGFP-tagged) - Human chemokine (C-C motif) ligand 27 (CCL27) 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.