LBX1 (NM_006562) Human Untagged Clone

SKU
SC303790
LBX1 (untagged)-Human ladybird homeobox 1 (LBX1)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LBX1
Synonyms homeobox; HPX-6; HPX6; LBX1H
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_006562 edited
ATGACTTCCAAGGAGGACGGCAAGGCGGCGCCGGGGGAGGAGCGGCGGCGCAGCCCGCTG
GACCACCTGCCTCCGCCTGCCAACTCCAACAAGCCACTGACGCCGTTCAGCATCGAGGAC
ATCCTCAACAAGCCGTCTGTGCGGAGAAGTTACTCGCTGTGCGGGGCGGCGCACCTGCTG
GCCGCCGCGGACAAGCACGCGCAGGGCGGCTTGCCCCTGGCGGGCCGCGCGCTGCTCTCG
CAGACCTCGCCGCTGTGCGCGCTGGAGGAGCTCGCCAGCAAGACGTTTAAGGGGCTGGAG
GTCAGCGTTCTGCAGGCAGCCGAAGGCCGCGACGGTATGACCATCTTTGGGCAGCGGCAG
ACCCCTAAGAAGCGGCGAAAGTCGCGCACGGCCTTCACCAACCACCAGATCTATGAATTG
GAAAAGCGCTTTCTATACCAGAAGTACCTGTCCCCCGCCGATCGCGACCAAATCGCGCAG
CAGCTGGGCCTCACCAACGCGCAAGTCATCACCTGGTTCCAGAATCGGCGCGCTAAGCTC
AAGCGGGACCTGGAGGAGATGAAGGCCGACGTAGAGTCCGCCAAGAAACTGGGCCCCAGC
GGGCAGATGGACATCGTGGCGCTGGCCGAACTCGAGCAGAACTCGGAGGCCACAGCCGGC
GGTGGCGGCGGCTGCGGCAGGGCCAAGTCGAGGCCCGGCTCTCCGGTCCTCCCCCCAGGC
GCCCCGAAGGCCCCGGGCGCTGGCGCCCTGCAGCTCTCGCCTGCCTCTCCGCTCACGGAC
CAGCCGGCCAGCAGCCAGGACTGCTCGGAGGACGAGGAAGACGAAGAGATCGACGTGGAC
GATTGA
Restriction Sites Please inquire
ACCN NM_006562
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006562.4, NP_006553.2
RefSeq Size 1287 bp
RefSeq ORF 846 bp
Locus ID 10660
UniProt ID P52954
Cytogenetics 10q24.32
Protein Families Transcription Factors
Summary This gene and the orthologous mouse gene were found by their homology to the Drosophila lady bird early and late homeobox genes. In the mouse, this gene is a key regulator of muscle precursor cell migration and is required for the acquisition of dorsal identities of forelimb muscles. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:LBX1 (NM_006562) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218048 LBX1 (Myc-DDK-tagged)-Human ladybird homeobox 1 (LBX1) 10 ug
$300.00
RC218048L1 Lenti ORF clone of Human ladybird homeobox 1 (LBX1), Myc-DDK-tagged 10 ug
$600.00
RC218048L2 Lenti ORF clone of Human ladybird homeobox 1 (LBX1), mGFP tagged 10 ug
$600.00
RC218048L3 Lenti ORF clone of Human ladybird homeobox 1 (LBX1), Myc-DDK-tagged 10 ug
$600.00
RC218048L4 Lenti ORF clone of Human ladybird homeobox 1 (LBX1), mGFP tagged 10 ug
$600.00
RG218048 LBX1 (tGFP-tagged) - Human ladybird homeobox 1 (LBX1) 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.