INSL5 (NM_005478) Human Untagged Clone

SKU
SC303652
INSL5 (untagged)-Human insulin-like 5 (INSL5)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol INSL5
Synonyms PRO182; UNQ156
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC303652 representing NM_005478.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGGGCTCCATTTTCACTCTGTTTTTATTCTCTGTCCTATTTGCCATCTCAGAAGTGCGGAGCAAG
GAGTCTGTGAGACTCTGTGGGCTAGAATACATACGGACAGTCATCTATATCTGTGCTAGCTCCAGGTGG
AGAAGGCATCAGGAGGGGATCCCTCAAGCTCAGCAAGCTGAGACAGGAAACTCCTTCCAGCTCCCACAT
AAACGTGAGTTTTCTGAGGAAAATCCAGCGCAAAACCTTCCGAAGGTGGATGCCTCAGGGGAAGACCGT
CTTTGGGGTGGACAGATGCCCACTGAAGAGCTTTGGAAGTCAAAGAAGCATTCAGTGATGTCAAGACAA
GATTTACAAACTTTGTGTTGCACTGATGGCTGTTCCATGACTGATTTGAGTGCTCTTTGCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_005478
Insert Size 408 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005478.4
RefSeq Size 718 bp
RefSeq ORF 408 bp
Locus ID 10022
UniProt ID Q9Y5Q6
Cytogenetics 1p31.3
Protein Families Secreted Protein
MW 15.3 kDa
Summary The protein encoded by this gene contains a classical signature of the insulin superfamily and is highly similar to relaxin 3 (RLN3/INSL7). [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:INSL5 (NM_005478) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210968 INSL5 (Myc-DDK-tagged)-Human insulin-like 5 (INSL5) 10 ug
$150.00
RC210968L3 Lenti ORF clone of Human insulin-like 5 (INSL5), Myc-DDK-tagged 10 ug
$450.00
RC210968L4 Lenti ORF clone of Human insulin-like 5 (INSL5), mGFP tagged 10 ug
$450.00
RG210968 INSL5 (tGFP-tagged) - Human insulin-like 5 (INSL5) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.