GAS2 (NM_005256) Human Untagged Clone

SKU
SC303611
GAS2 (untagged)-Human growth arrest-specific 2 (GAS2), transcript variant 1
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GAS2
Synonyms GAS-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC303611 representing NM_005256.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGCACTGCTCTGAGCCCAAAGGTACGCAGTGGACCTGGCCTCTCTGATATGCATCAGTATAGCCAA
TGGCTAGCCAGCAGACATGAAGCTAATTTGCTACCAATGAAAGAAGATCTGGCCTTGTGGTTAACCAAT
CTATTAGGGAAGGAGATTACAGCAGAAACTTTTATGGAGAAGTTGGACAATGGTGCCTTGCTCTGTCAA
CTTGCAGAAACTATGCAGGAGAAATTCAAGGAGAGCATGGATGCTAACAAGCCCACAAAGAATCTACCG
TTGAAGAAGATCCCATGCAAAACCAGTGCACCCTCGGGCTCCTTTTTTGCCAGAGACAATACAGCAAAT
TTCTTATCCTGGTGCCGAGATTTAGGGGTGGATGAAACGTGTCTATTTGAATCGGAAGGTTTGGTCCTC
CACAAGCAACCCAGAGAAGTGTGTCTCTGTCTGCTAGAGCTTGGCCGGATTGCAGCCAGGTATGGTGTG
GAGCCTCCTGGTTTGATAAAGCTGGAAAAAGAGATTGAACAAGAAGAAACACTTTCTGCCCCTTCTCCT
TCACCTTCTCCTTCATCAAAGTCTTCTGGAAAAAAGAGTACAGGAAACTTACTGGATGATGCAGTGAAA
CGAATTTCTGAAGATCCTCCTTGCAAATGCCCAAACAAGTTCTGTGTGGAGCGGCTCTCCCAAGGAAGA
TACCGAGTGGGAGAAAAGATCCTCTTCATTAGGATGCTGCACAACAAACATGTCATGGTCCGTGTGGGA
GGAGGCTGGGAAACTTTTGCAGGGTATTTGTTGAAACACGACCCCTGCCGAATGCTGCAGATCTCCCGT
GTGGATGGCAAAACATCCCCTATCCAAAGCAAATCTCCAACTCTAAAGGACATGAATCCAGATAACTAC
TTGGTGGTCTCTGCCAGTTATAAGGCTAAGAAGGAAATTAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_005256
Insert Size 942 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005256.3
RefSeq Size 2031 bp
RefSeq ORF 942 bp
Locus ID 2620
UniProt ID O43903
Cytogenetics 11p14.3
Protein Families Druggable Genome
MW 34.9 kDa
Summary The protein encoded by this gene is a caspase-3 substrate that plays a role in regulating microfilament and cell shape changes during apoptosis. It can also modulate cell susceptibility to p53-dependent apoptosis by inhibiting calpain activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2017]
Transcript Variant: This variant (1) encodes the longer isoform (a). Variants 1, 2, and 3 encode the same isoform.
Write Your Own Review
You're reviewing:GAS2 (NM_005256) Human Untagged Clone
Your Rating
SKU Description Size Price
RC223624 GAS2 (Myc-DDK-tagged)-Human growth arrest-specific 2 (GAS2), transcript variant 1 10 ug
$300.00
RC223624L3 Lenti ORF clone of Human growth arrest-specific 2 (GAS2), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC223624L4 Lenti ORF clone of Human growth arrest-specific 2 (GAS2), transcript variant 1, mGFP tagged 10 ug
$600.00
RG223624 GAS2 (tGFP-tagged) - Human growth arrest-specific 2 (GAS2), transcript variant 1 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.