HESX1 (NM_003865) Human Untagged Clone

SKU
SC303393
HESX1 (untagged)-Human HESX homeobox 1 (HESX1)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HESX1
Synonyms ANF; CPHD5; RPX
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC303393 representing NM_003865.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTCCCAGCCTTCAGGAAGGCGCTCAGCTCGGGGAAAACAAACCCTCAACTTGCTCCTTTTCAATT
GAGAGAATCTTAGGACTGGACCAGAAGAAAGACTGTGTTCCATTAATGAAACCCCACAGGCCCTGGGCA
GACACCTGCAGCTCATCAGGGAAAGATGGTAACTTATGTCTACATGTCCCAAATCCTCCCAGTGGGATT
TCATTCCCTAGCGTGGTGGATCACCCAATGCCAGAAGAAAGAGCTTCGAAATATGAAAATTACTTTTCA
GCCTCAGAAAGACTGTCTTTGAAAAGAGAGTTGAGTTGGTATAGAGGCCGAAGACCAAGAACTGCTTTT
ACTCAAAACCAGATTGAAGTGTTAGAAAATGTCTTTAGAGTAAACTGCTATCCTGGTATCGATATTAGA
GAAGACTTAGCTCAAAAATTGAATCTAGAGGAAGACAGAATCCAGATTTGGTTTCAAAATCGGCGTGCA
AAACTGAAAAGGTCCCATAGAGAATCACAGTTTCTAATGGCGAAAAAAAATTTCAACACAAATCTGCTG
GAATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_003865
Insert Size 558 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003865.2
RefSeq Size 1182 bp
RefSeq ORF 558 bp
Locus ID 8820
UniProt ID Q9UBX0
Cytogenetics 3p14.3
Protein Families Druggable Genome, Transcription Factors
MW 21.4 kDa
Summary This gene encodes a conserved homeobox protein that is a transcriptional repressor in the developing forebrain and pituitary gland. Mutations in this gene are associated with septooptic dysplasia, HESX1-related growth hormone deficiency, and combined pituitary hormone deficiency. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:HESX1 (NM_003865) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210107 HESX1 (Myc-DDK-tagged)-Human HESX homeobox 1 (HESX1) 10 ug
$300.00
RC210107L1 Lenti ORF clone of Human HESX homeobox 1 (HESX1), Myc-DDK-tagged 10 ug
$600.00
RC210107L2 Lenti ORF clone of Human HESX homeobox 1 (HESX1), mGFP tagged 10 ug
$600.00
RC210107L3 Lenti ORF clone of Human HESX homeobox 1 (HESX1), Myc-DDK-tagged 10 ug
$600.00
RC210107L4 Lenti ORF clone of Human HESX homeobox 1 (HESX1), mGFP tagged 10 ug
$600.00
RG210107 HESX1 (tGFP-tagged) - Human HESX homeobox 1 (HESX1) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.