DOC2B (NM_003585) Human Untagged Clone

CAT#: SC303353

DOC2B (untagged)-Human double C2-like domains, beta (DOC2B)


  "NM_003585" in other vectors (6)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "DOC2B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DOC2B
Synonyms DOC2BL
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_003585 edited
GCTGCCTGCATGACCCTCCGGCGGCGCGGGGAGAAGGCGACCATCAGCATCCAGGAGCAT
ATGGCCATCGACGTGTGCCCCGGCCCCATCCGTCCCATCAAGCAGATCTCCGACTACTTC
CCCCGCTTCCCGCGGGGCCTGCCCCCGGACGCCGGGCCCCGAGCCGCTGCACCCCCGGAC
GCCCCCGCGCGCCCGGCTGTGGCCGGTGCCGGCCGCCGCAGCCCCTCCGACGGCGCCCGC
GAGGACGACGAGGATGTGGACCAGCTCTTCGGAGCCTACGGCTCCAGCCCGGGCCCCAGC
CCGGGTCCCAGCCCCGCGCGGCCGCCAGCCAAGCCGCCGGAGGACGAGCCGGACGCCGAC
GGCTACGAGTCGGACGACTGCACTGCCCTGGGCACGCTGGACTTCAGCCTGCTGTATGAC
CAGGAGAACAACGCCCTCCACTGCACCATCACCAAGGCCAAGGGCCTGAAGCCAATGGAC
CACAATGGGCTGGCAGACCCCTACGTCAAGCTGCACCTGCTGCCAGGAGCCAGTAAGGCA
AATAAGCTCAGAACAAAAACTCTCCGTAACACTCTGAACCCCACATGGAACGAGACCCTC
ACTTACTACGGGATCACAGATGAAGACATGATCCGCAAGACCCTGCGGATCTCTGTGTGT
GACGAGGACAAATTCCGGCACAATGAGTTCATCGGGGAGACACGTGTGCCCCTGAAGAAG
CTGAAACCCAACCACACCAAGACCTTCAACATCTGCCTGGAGAAGCAGCTGCCGGTGGAC
AAGACTGAAGACAAGTCCCTGGAGGAGCGGGGCCGCATCCTCATCTCCCTCAAGTACAGC
TCACAGAAGCAAGGCCTGCTGGTAGGCATCGTGCGGTGCGCCCACCTGGCCGCCATGGAC
GCCAACGGCTACTCGGACCCCTACGTGAAAACATACCTGAGGCCAGATGTGGACAAGAAA
TCCAAACATAAGACAGCGGTGAAGAAAAAAACCCTGAACCCGGAGTTTAATGAGGAGTTC
TGTTACGAGATCAAGCATGGGGACCTGGCCAAGAAGTCCCTGGAGGTCACCGTTTGGGAT
TACGACATTGGAAAATCCAACGATTTCATTGGTGGTGTGGTTCTGGGCATCCACGCCAAG
GGGGAGCGCCTGAAGCACTGGTTTGACTGCCTGAAGAACAAGGACAAGCGCATCGAGCGC
TGGCACACGCTCACCAGCGAGCTCCCAGGGGCTGTGCTCAGCGACTGA
Restriction Sites Please inquire     
ACCN NM_003585
Insert Size 1300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003585.1, NP_003576.1
RefSeq Size 2030 bp
RefSeq ORF 1239 bp
Locus ID 8447
UniProt ID Q14184
Cytogenetics 17p13.3
Gene Summary There are at least two protein isoforms of the Double C2 protein, namely alpha (DOC2A) and beta (DOC2B), which contain two C2-like domains. DOC2A and DOC2B are encoded by different genes; these genes are at times confused with the unrelated DAB2 gene which was initially named DOC-2. DOC2B is expressed ubiquitously and is suggested to be involved in Ca(2+)-dependent intracellular vesicle trafficking in various types of cells. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.