DOC2B (NM_003585) Human Untagged Clone

SKU
SC303353
DOC2B (untagged)-Human double C2-like domains, beta (DOC2B)
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DOC2B
Synonyms DOC2BL
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_003585 edited
GCTGCCTGCATGACCCTCCGGCGGCGCGGGGAGAAGGCGACCATCAGCATCCAGGAGCAT
ATGGCCATCGACGTGTGCCCCGGCCCCATCCGTCCCATCAAGCAGATCTCCGACTACTTC
CCCCGCTTCCCGCGGGGCCTGCCCCCGGACGCCGGGCCCCGAGCCGCTGCACCCCCGGAC
GCCCCCGCGCGCCCGGCTGTGGCCGGTGCCGGCCGCCGCAGCCCCTCCGACGGCGCCCGC
GAGGACGACGAGGATGTGGACCAGCTCTTCGGAGCCTACGGCTCCAGCCCGGGCCCCAGC
CCGGGTCCCAGCCCCGCGCGGCCGCCAGCCAAGCCGCCGGAGGACGAGCCGGACGCCGAC
GGCTACGAGTCGGACGACTGCACTGCCCTGGGCACGCTGGACTTCAGCCTGCTGTATGAC
CAGGAGAACAACGCCCTCCACTGCACCATCACCAAGGCCAAGGGCCTGAAGCCAATGGAC
CACAATGGGCTGGCAGACCCCTACGTCAAGCTGCACCTGCTGCCAGGAGCCAGTAAGGCA
AATAAGCTCAGAACAAAAACTCTCCGTAACACTCTGAACCCCACATGGAACGAGACCCTC
ACTTACTACGGGATCACAGATGAAGACATGATCCGCAAGACCCTGCGGATCTCTGTGTGT
GACGAGGACAAATTCCGGCACAATGAGTTCATCGGGGAGACACGTGTGCCCCTGAAGAAG
CTGAAACCCAACCACACCAAGACCTTCAACATCTGCCTGGAGAAGCAGCTGCCGGTGGAC
AAGACTGAAGACAAGTCCCTGGAGGAGCGGGGCCGCATCCTCATCTCCCTCAAGTACAGC
TCACAGAAGCAAGGCCTGCTGGTAGGCATCGTGCGGTGCGCCCACCTGGCCGCCATGGAC
GCCAACGGCTACTCGGACCCCTACGTGAAAACATACCTGAGGCCAGATGTGGACAAGAAA
TCCAAACATAAGACAGCGGTGAAGAAAAAAACCCTGAACCCGGAGTTTAATGAGGAGTTC
TGTTACGAGATCAAGCATGGGGACCTGGCCAAGAAGTCCCTGGAGGTCACCGTTTGGGAT
TACGACATTGGAAAATCCAACGATTTCATTGGTGGTGTGGTTCTGGGCATCCACGCCAAG
GGGGAGCGCCTGAAGCACTGGTTTGACTGCCTGAAGAACAAGGACAAGCGCATCGAGCGC
TGGCACACGCTCACCAGCGAGCTCCCAGGGGCTGTGCTCAGCGACTGA
Restriction Sites Please inquire
ACCN NM_003585
Insert Size 1300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003585.1, NP_003576.1
RefSeq Size 2030 bp
RefSeq ORF 1239 bp
Locus ID 8447
UniProt ID Q14184
Cytogenetics 17p13.3
Summary There are at least two protein isoforms of the Double C2 protein, namely alpha (DOC2A) and beta (DOC2B), which contain two C2-like domains. DOC2A and DOC2B are encoded by different genes; these genes are at times confused with the unrelated DAB2 gene which was initially named DOC-2. DOC2B is expressed ubiquitously and is suggested to be involved in Ca(2+)-dependent intracellular vesicle trafficking in various types of cells. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:DOC2B (NM_003585) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218949 DOC2B (Myc-DDK-tagged)-Human double C2-like domains, beta (DOC2B) 10 ug
$457.00
RC218949L1 Lenti ORF clone of Human double C2-like domains, beta (DOC2B), Myc-DDK-tagged 10 ug
$757.00
RC218949L2 Lenti ORF clone of Human double C2-like domains, beta (DOC2B), mGFP tagged 10 ug
$757.00
RC218949L3 Lenti ORF clone of Human double C2-like domains, beta (DOC2B), Myc-DDK-tagged 10 ug
$757.00
RC218949L4 Lenti ORF clone of Human double C2-like domains, beta (DOC2B), mGFP tagged 10 ug
$757.00
RG218949 DOC2B (tGFP-tagged) - Human double C2-like domains, beta (DOC2B) 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.