XRCC4 (NM_003401) Human Untagged Clone

SKU
SC303300
XRCC4 (untagged)-Human X-ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4), transcript variant 1
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol XRCC4
Synonyms SSMED
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC303300 representing NM_003401.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGAGAAAAATAAGCAGAATCCACCTTGTTTCTGAACCCAGTATAACTCATTTTCTACAAGTATCT
TGGGAGAAAACACTGGAATCTGGTTTTGTTATTACACTTACTGATGGTCATTCAGCATGGACTGGGACA
GTTTCTGAATCAGAGATTTCCCAAGAAGCTGATGACATGGCAATGGAAAAAGGGAAATATGTTGGTGAA
CTGAGAAAAGCATTGTTGTCAGGAGCAGGACCAGCTGATGTATACACGTTTAATTTTTCTAAAGAGTCT
TGTTATTTCTTCTTTGAGAAAAACCTGAAAGATGTCTCATTCAGACTTGGTTCCTTCAACCTAGAGAAA
GTTGAAAACCCAGCTGAAGTCATTAGAGAACTTATTTGTTATTGCTTGGACACCATTGCAGAAAATCAA
GCCAAAAATGAGCACCTGCAGAAAGAAAATGAAAGGCTTCTGAGAGATTGGAATGATGTTCAAGGACGA
TTTGAAAAATGTGTGAGTGCTAAGGAAGCTTTGGAGACTGATCTTTATAAGCGGTTTATTCTGGTGTTG
AATGAGAAGAAAACAAAAATCAGAAGTTTGCATAATAAATTATTAAATGCAGCTCAAGAACGAGAAAAG
GACATCAAACAAGAAGGGGAAACTGCAATCTGTTCTGAAATGACTGCTGACCGAGATCCAGTCTATGAT
GAGAGTACTGATGAGGAAAGTGAAAACCAAACTGATCTCTCTGGGTTGGCTTCAGCTGCTGTAAGTAAA
GATGATTCCATTATTTCAAGTCTTGATGTCACTGATATTGCACCAAGTAGAAAAAGGAGACAGCGAATG
CAAAGAAATCTTGGGACAGAACCTAAAATGGCTCCTCAGGAGAATCAGCTTCAAGAAAAGGAAAAGCCT
GATTCTTCACTACCTGAGACGTCTAAAAAGGAGCACATCTCAGCTGAAAACATGTCTTTAGAAACTCTG
AGAAACAGCAGCCCAGAAGACCTCTTTGATGAGATTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_003401
Insert Size 1005 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003401.4
RefSeq Size 1777 bp
RefSeq ORF 1005 bp
Locus ID 7518
UniProt ID Q13426
Cytogenetics 5q14.2
Protein Families Druggable Genome
Protein Pathways Non-homologous end-joining
MW 38.1 kDa
Summary The protein encoded by this gene functions together with DNA ligase IV and the DNA-dependent protein kinase in the repair of DNA double-strand breaks. This protein plays a role in both non-homologous end joining and the completion of V(D)J recombination. Mutations in this gene can cause short stature, microcephaly, and endocrine dysfunction (SSMED). Alternate transcript variants such as NM_022406 are unlikely to be expressed in some individuals due to a polymorphism (rs1805377) in the last splice acceptor site. [provided by RefSeq, Oct 2019]
Transcript Variant: This variant (1) encodes isoform 1. Variants 1 and 3 encode the same isoform (1).
Write Your Own Review
You're reviewing:XRCC4 (NM_003401) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212684 XRCC4 (Myc-DDK-tagged)-Human X-ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4), transcript variant 1 10 ug
$457.00
RC212684L1 Lenti ORF clone of Human X-ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC212684L2 Lenti ORF clone of Human X-ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4), transcript variant 1, mGFP tagged 10 ug
$757.00
RC212684L3 Lenti ORF clone of Human X-ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC212684L4 Lenti ORF clone of Human X-ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4), transcript variant 1, mGFP tagged 10 ug
$757.00
RG212684 XRCC4 (tGFP-tagged) - Human X-ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4), transcript variant 1 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.