SGLT2 (SLC5A2) (NM_003041) Human Untagged Clone

CAT#: SC303267

Reviews ()
Write a review

SLC5A2 (untagged)-Human solute carrier family 5 (sodium/glucose cotransporter), member 2 (SLC5A2)



  "NM_003041" in other vectors (6)

Reconstitution Protocol

USD 616.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "SLC5A2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC5A2
Synonyms SGLT2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_003041 edited
ATGGAGGAGCACACAGAGGCAGGCTCGGCACCAGAGATGGGGGCCCAGAAGGCCCTGATT
GACAATCCTGCTGACATCCTAGTCATTGCTGCATATTTCCTGCTGGTCATTGGCGTTGGC
TTGTGGTCCATGTGCAGAACCAACAGAGGCACTGTGGGCGGCTACTTCCTGGCAGGACGC
AGCATGGTGTGGTGGCCGGTTGGGGCCTCTCTCTTCGCCAGCAACATCGGCAGTGGCCAC
TTTGTGGGCCTGGCAGGGACTGGCGCTGCAAGTGGCTTGGCTGTTGCTGGATTCGAGTGG
AATGCGCTCTTCGTGGTGCTGCTACTGGGCTGGCTGTTTGCACCCGTGTACCTGACAGCG
GGGGTCATCACGATGCCACAGTACCTGCGCAAGCGCTTCGGCGGCCGCCGCATCCGCCTC
TACCTGTCTGTGCTCTCCCTTTTCCTGTACATCTTCACCAAGATCTCAGTGGACATGTTC
TCCGGAGCTGTATTCATCCAGCAGGCTCTGGGCTGGAACATCTATGCCTCCGTCATCGCG
CTTCTGGGCATCACCATGATTTACACGGTGACAGGAGGGCTGGCCGCGCTGATGTACACG
GACACGGTACAGACCTTCGTCATTCTGGGGGGCGCCTGCATCCTCATGGGTTACGCCTTC
CACGAGGTGGGCGGGTATTCGGGTCTCTTCGACAAATACCTGGGAGCAGCGACTTCGCTG
ACGGTGTCCGAGGATCCAGCCGTGGGAAACATCTCCAGCTTCTGCTATCGACCCCGGCCC
GACTCCTACCACCTGCTCCGGCACCCCGTGACCGGGGATCTGCCGTGGCCCGCGCTGCTC
CTCGGACTCACAATCGTCTCGGGCTGGTACTGGTGCAGCGACCAGGTCATCGTGCAGCGC
TGCCTGGCCGGGAAGAGCCTGACCCACATCAAGGCGGGCTGCATCCTGTGTGGGTACCTG
AAGCTGACGCCCATGTTTCTCATGGTCATGCCAGGCATGATCAGCCGCATTCTGTACCCA
GACGAGGTGGCGTGCGTGGTGCCTGAGGTGTGCAGGCGCGTGTGCGGCACGGAGGTGGGC
TGCTCCAACATCGCCTACCCGCGGCTCGTCGTGAAGCTCATGCCCAACGGTCTGCGCGGA
CTCATGCTGGCGGTCATGCTGGCCGCGCTCATGTCCTCGCTGGCCTCCATCTTCAACAGC
AGCAGCACGCTCTTCACCATGGACATCTACACGCGCCTGCGGCCACGCGCCGGCGACCGC
GAGCTGCTGCTGGTGGGACGGCTCTGGGTGGTGTTCATCGTGGTAGTGTCGGTGGCCTGG
CTTCCCGTGGTGCAGGCGGCACAGGGCGGGCAGCTCTTCGATTACATCCAGGCAGTCTCT
AGCTACCTGGCACCGCCCGTGTCCGCCGTCTTCGTGCTGGCGCTCTTCGTGCCGCGCGTT
AATGAGCAGGGCGCCTTCTGGGGACTCATCGGGGGCCTGCTGATGGGCCTGGCACGCCTG
ATTCCCGAGTTCTCCTTCGGCTCGGGCAGCTGTGTGCAGCCCTCGGCGTGCCCAGCTTTC
CTCTGCGGCGTGCACTACCTCTACTTCGCCATTGTGCTGTTCTTCTGCTCTGGCCTCCTC
ACCCTCACGGTCTCCCTGTGCACCGCGCCCATCCCCAGAAAGCACCTCCACCGCCTGGTC
TTCAGTCTCCGGCATAGCAAGGAGGAACGGGAGGACCTGGATGCTGATGAGCAGCAAGGC
TCCTCACTCCCTGTACAGAATGGGTGCCCAGAGAGTGCCATGGAGATGAATGAGCCCCAG
GCCCCGGCACCAAGCCTCTTCCGCCAGTGCCTGCTCTGGTTTTGTGGAATGAGCAGAGGT
GGGGTGGGCAGTCCTCCGCCCCTTACCCAGGAGGAGGCAGCGGCAGCAGCCAGGCGGCTG
GAGGACATCAGCGAGGACCCGAGCTGGGCCCGTGTGGTCAACCTCAATGCCCTGCTCATG
ATGGCAGTGGCCGTGTTCCTCTGGGGCTTCTATGCCTAA
>OriGene 5' read for NM_003041 unedited
TCAACTTGTATACGACTCCTATAGGGCGGCCGCGATCTCTCGAGCTCGGTACCTCGCGAA
TGCATCTAGATATCGGATCCCGACACGAATTCATGGAGGAGCACACAGAGGCAGGCTCGG
CACCAGAGATGGGGGCCCAGAAGGCCCTGATTGACAATCCTGCTGACATCCTAGTCATTG
CTGCATATTTCCTGCTGGTCATTGGCGTTGGCTTGTGGTCCATGTGCAGAACCAACAGAG
GCACTGTGGGCGGCTACTTCCTGGCAGGACGCAGCATGGTGTGGTGGCCGGTTGGGGCCT
CTCTCTTCGCCAGCAACATCGGCAGTGGCCACTTTGTGGGCCTGGCAGGGACTGGCGCTG
CAAGTGGCTTGGCTGTTGCTGGATTCGAGTGGAATGCGCTCTTCGTGGTGCTGCTACTGG
GCTGGCTGTTTGCACCCGTGTACCTGACAGCGGGGGTCATCACGATGCCACAGTACCTGC
GCAAGCGCTTCGGCGGCCGCCGCATCCGCCTCTACCTGTCTGTGCTCTCCCTTTTCCTGT
ACATCTTCACCAAGATCTCAGTGGACATGTTCTCCGGAGCTGTATTCATCCAGCAGGCTC
TGGGCTGGAACATCTATGCCTCCGTCATCGCGCTTCTGGGCATCACCATGATTTACACGG
TGACAGGAGGGCTGGCCGCGCTGATGTACACGGACACGGTACAGACCTTCGTCATTCTGG
GGGGCGCCTGCATCCTCATGGGTTACGCCTTCCACGAGTGGGCGGGTATTCGGGTCTCTT
CGACAAATACCTGGGAGCAGCGACTTCGCTGACGGTGTCCGAGGATCCAGCCGTGGGAAA
CATCTCCAGCTTCTGCTATCGACCCCGGCCCGACTCCTACCACCTGCTCCGCACCCCGTG
ACCGGGGATCTGCCGTGGCCCGCCGCTGCTCCCTCGGACTTCAC
Restriction Sites Please inquire     
ACCN NM_003041
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003041.2, NP_003032.1
RefSeq Size 2271 bp
RefSeq ORF 2019 bp
Locus ID 6524
UniProt ID P31639
Cytogenetics 16p11.2
Protein Families Transmembrane
Gene Summary This gene encodes a member of the sodium glucose cotransporter family which are sodium-dependent glucose transport proteins. The encoded protein is the major cotransporter involved in glucose reabsorption in the kidney. Mutations in this gene are associated with renal glucosuria. Two transcript variants, one protein-coding and one not, have been found for this gene. [provided by RefSeq, Feb 2015]
Transcript Variant: This variant (1) is the longer, protein-coding transcript.

Other Versions

Frequently bought together (4)
Rabbit polyclonal anti-SLC5A2 antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.