Parvalbumin (PVALB) (NM_002854) Human Untagged Clone

SKU SC303247

PVALB (untagged)-Human parvalbumin (PVALB)

Product Data

• Type: Human Untagged Clone
• Target Symbol: Parvalbumin
• Synonyms: D22S749
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_002854 edited; CCAGCCTTTCAGTGCAGGCTCCAGCCCTCCACCCCCACCCGAGTTGCAGGATGTCGATGA; CAGACTTGCTGAACGCTGAGGACATCAAGAAGGCGGTGGGAGCCTTTAGCGCTACCGACT; CCTTCGACCACAAAAAGTTCTTCCAAATGGTCGGCCTGAAGAAAAAGAGTGCGGATGATG; TGAAGAAGGTGTTTCACATGCTGGACAAGGACAAAAGTGGCTTCATCGAGGAGGATGAGC; TGGGATTCATCCTAAAAGGCTTCTCCCCAGATGCCAGAGACCTGTCTGCTAAAGAAACCA; AGATGCTGATGGCTGCTGGAGACAAAGATGGGGACGGCAAAATTGGGGTTGACGAATTCT; CCACTCTGGTGGCTGAAAGCTAAGAAGCACTGACTGCCCCTGGTCTTCCACCTCTCTG;
• Restriction Sites: Please inquire
• ACCN: NM_002854
• Insert Size: 400 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002854.2.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_002854.2, NP_002845.1
• RefSeq Size: 586 bp
• RefSeq ORF: 333 bp
• Locus ID: 5816
• UniProt ID: P20472
• Cytogenetics: 22q12.3
• Summary: The protein encoded by this gene is a high affinity calcium ion-binding protein that is structurally and functionally similar to calmodulin and troponin C. The encoded protein is thought to be involved in muscle relaxation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]; Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.