PAEP (NM_002571) Human Untagged Clone
SKU
SC303222
PAEP (untagged)-Human progestagen-associated endometrial protein (PAEP), transcript variant 2
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | PAEP |
Synonyms | GD; GdA; GdF; GdS; PAEG; PEP; PP14; ZIF-1 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_002571 edited
ATGCTGTGCCTCCTGCTCACCCTGGGCGTGGCCCTGGTCTGTGGTGTCCCGGCCATGGAC ATCCCCCAGACCAAGCAGGACCTGGAGCTCCCAAAGTTGGCAGGGACCTGGCACTCCATG GCCATGGCGACCAACAACATCTCCCTCATGGCGACACTGAAGGCCCCTCTGAGGGTCCAC ATCACCTCACTGTTGCCCACCCCCGAGGACAACCTGGAGATCGTTCTGCACAGATGGGAG AACAACAGCTGTGTTGAGAAGAAGGTCCTTGGAGAGAAGACTGAGAATCCAAAGAAGTTC AAGATCAACTATACGGTGGCGAACGAGGCCACGCTGCTCGATACTGACTACGACAATTTC CTGTTTCTCTGCCTACAGGACACCACCACCCCCATCCAGAGCATGATGTGCCAGTACCTG GCCAGAGTCCTGGTGGAGGACGATGAGATCATGCAGGGATTCATCAGGGCTTTCAGGCCC CTGCCCAGGCACCTATGGTACTTGCTGGACTTGAAACAGATGGAAGAGCCGTGCCGTTTC TAGGTGAGCTCCTGCCTGGTCCTGCCTCCTGGCTCACCTCCGCCTCCAGGAGACCAGACT CCCACCCTTCCACACCTCCAGAGCAGTGGGACTTCCTCCTGCCCTTT |
Restriction Sites | Please inquire |
ACCN | NM_002571 |
Insert Size | 650 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002571.2. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_002571.2, NP_002562.2 |
RefSeq Size | 828 bp |
RefSeq ORF | 543 bp |
Locus ID | 5047 |
UniProt ID | P09466 |
Cytogenetics | 9q34.3 |
Protein Families | Druggable Genome |
Summary | This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015] Transcript Variant: This variant (2) uses an alternate, in-frame splice site in the 3' UTR, compared to variant 1. It encodes the same protein as variant 1. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC210121 | PAEP (Myc-DDK-tagged)-Human progestagen-associated endometrial protein (PAEP), transcript variant 2 | 10 ug |
$300.00
|
|
RC210121L3 | Lenti ORF clone of Human progestagen-associated endometrial protein (PAEP), transcript variant 2, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC210121L4 | Lenti ORF clone of Human progestagen-associated endometrial protein (PAEP), transcript variant 2, mGFP tagged | 10 ug |
$600.00
|
|
RG210121 | PAEP (tGFP-tagged) - Human progestagen-associated endometrial protein (PAEP), transcript variant 2 | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.