Motilin (MLN) (NM_002418) Human Untagged Clone

SKU
SC303197
MLN (untagged)-Human motilin (MLN), transcript variant 1
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Motilin
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC303197 representing NM_002418.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTATCCCGTAAGGCTGTGGCTGCTCTGCTGGTGGTGCATGTAGCTGCCATGCTGGCCTCCCAGACG
GAAGCCTTCGTCCCCATCTTCACCTATGGCGAACTCCAGAGGATGCAGGAAAAGGAACGGAATAAAGGG
CAAAAGAAATCCCTGAGTGTATGGCAGAGGTCTGGGGAGGAAGGTCCTGTAGACCCTGCGGAGCCCATC
AGGGAAGAAGAAAACGAAATGATCAAGCTGACTGCTCCTCTGGAAATTGGAATGAGGATGAACTCCAGA
CAGCTGGAAAAGTACCCGGCCACCCTGGAAGGGCTGCTGAGTGAGATGCTTCCCCAGCATGCAGCCAAG
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_002418
Insert Size 348 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002418.2
RefSeq Size 572 bp
RefSeq ORF 348 bp
Locus ID 4295
UniProt ID P12872
Cytogenetics 6p21.31
Protein Families Druggable Genome, Secreted Protein, Transmembrane
MW 12.9 kDa
Summary This gene encodes a small peptide hormone that is secreted by cells of the small intestine to regulate gastrointestinal contractions and motility. Proteolytic processing of the secreted protein produces the mature peptide and a byproduct referred to as motilin-associated peptide (MAP). Three transcript variants encoding different preproprotein isoforms but the same mature peptide have been found for this gene. [provided by RefSeq, May 2010]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
Write Your Own Review
You're reviewing:Motilin (MLN) (NM_002418) Human Untagged Clone
Your Rating
SKU Description Size Price
RC222245 MLN (Myc-DDK-tagged)-Human motilin (MLN), transcript variant 1 10 ug
$150.00
RC222245L3 Lenti ORF clone of Human motilin (MLN), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC222245L4 Lenti ORF clone of Human motilin (MLN), transcript variant 1, mGFP tagged 10 ug
$450.00
RG222245 MLN (tGFP-tagged) - Human motilin (MLN), transcript variant 1 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.