IFNA5 (NM_002169) Human Untagged Clone

SKU
SC303132
IFNA5 (untagged)-Human interferon, alpha 5 (IFNA5)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol IFNA5
Synonyms IFN-alpha-5; IFN-alphaG; INA5; INFA5; leIF G
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC303132 representing NM_002169.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCTTGCCCTTTGTTTTACTGATGGCCCTGGTGGTGCTCAACTGCAAGTCAATCTGTTCTCTGGGC
TGTGATCTGCCTCAGACCCACAGCCTGAGTAACAGGAGGACTTTGATGATAATGGCACAAATGGGAAGA
ATCTCTCCTTTCTCCTGCCTGAAGGACAGACATGACTTTGGATTTCCTCAGGAGGAGTTTGATGGCAAC
CAGTTCCAGAAGGCTCAAGCCATCTCTGTCCTCCATGAGATGATCCAGCAGACCTTCAATCTCTTCAGC
ACAAAGGACTCATCTGCTACTTGGGATGAGACACTTCTAGACAAATTCTACACTGAACTTTACCAGCAG
CTGAATGACCTGGAAGCCTGTATGATGCAGGAGGTTGGAGTGGAAGACACTCCTCTGATGAATGTGGAC
TCTATCCTGACTGTGAGAAAATACTTTCAAAGAATCACCCTCTATCTGACAGAGAAGAAATACAGCCCT
TGTGCATGGGAGGTTGTCAGAGCAGAAATCATGAGATCCTTCTCTTTATCAGCAAACTTGCAAGAAAGA
TTAAGGAGGAAGGAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_002169
Insert Size 570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002169.2
RefSeq Size 700 bp
RefSeq ORF 570 bp
Locus ID 3442
UniProt ID P01569
Cytogenetics 9p21.3
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Antigen processing and presentation, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, Regulation of autophagy, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway
MW 21.9 kDa
Summary Produced by macrophages, IFN-alpha have antiviral activities. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:IFNA5 (NM_002169) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210825 IFNA5 (Myc-DDK-tagged)-Human interferon, alpha 5 (IFNA5) 10 ug
$300.00
RC210825L1 Lenti ORF clone of Human interferon, alpha 5 (IFNA5), Myc-DDK-tagged 10 ug
$600.00
RC210825L2 Lenti ORF clone of Human interferon, alpha 5 (IFNA5), mGFP tagged 10 ug
$600.00
RC210825L3 Lenti ORF clone of Human interferon, alpha 5 (IFNA5), Myc-DDK-tagged 10 ug
$600.00
RC210825L4 Lenti ORF clone of Human interferon, alpha 5 (IFNA5), mGFP tagged 10 ug
$600.00
RG210825 IFNA5 (tGFP-tagged) - Human interferon, alpha 5 (IFNA5) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.