GGPS1 (NM_001037277) Human Untagged Clone

SKU
SC302871
GGPS1 (untagged)-Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GGPS1
Synonyms GGPPS; GGPPS1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC302871 representing NM_001037277.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGAAGACTCAAGAAACAGTCCAAAGAATTCTTCTAGAACCCTATAAATACTTACTTCAGTTACCA
GGTAAACAAGTGAGAACCAAACTTTCACAGGCATTTAATCATTGGCTGAAAGTTCCAGAGGACAAGCTA
CAGATTATTATTGAAGTGACAGAAATGTTGCATAATGCCAGTTTACTCATCGATGATATTGAAGACAAC
TCAAAACTCCGACGTGGCTTTCCAGTGGCCCACAGCATCTATGGAATCCCATCTGTCATCAATTCTGCC
AATTACGTGTATTTCCTTGGCTTGGAGAAAGTCTTAACCCTTGATCACCCAGATGCAGTGAAGCTTTTT
ACCCGCCAGCTTTTGGAACTCCATCAGGGACAAGGCCTAGATATTTACTGGAGGGATAATTACACTTGT
CCCACTGAAGAAGAATATAAAGCTATGGTGCTGCAGAAAACAGGTGGACTGTTTGGATTAGCAGTAGGT
CTCATGCAGTTGTTCTCTGATTACAAAGAAGATTTAAAACCGCTACTTAATACACTTGGGCTCTTTTTC
CAAATTAGGGATGATTATGCTAATCTACACTCCAAAGAATATAGTGAAAACAAAAGTTTTTGTGAAGAT
CTGACAGAGGGAAAGTTCTCATTTCCTACTATTCATGCTATTTGGTCAAGGCCTGAAAGCACCCAGGTG
CAGAATATCTTGCGCCAGAGAACAGAAAACATAGATATAAAAAAATACTGTGTACATTATCTTGAGGAT
GTAGGTTCTTTTGAATACACTCGTAATACCCTTAAAGAGCTTGAAGCTAAAGCCTATAAACAGATTGAT
GCACGTGGTGGGAACCCTGAGCTAGTAGCCTTAGTAAAACACTTAAGTAAGATGTTCAAAGAAGAAAAT
GAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001037277
Insert Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001037277.1
RefSeq Size 2757 bp
RefSeq ORF 903 bp
Locus ID 9453
UniProt ID O95749
Cytogenetics 1q42.3
Protein Pathways Metabolic pathways, Terpenoid backbone biosynthesis
MW 34.9 kDa
Summary This gene is a member of the prenyltransferase family and encodes a protein with geranylgeranyl diphosphate (GGPP) synthase activity. The enzyme catalyzes the synthesis of GGPP from farnesyl diphosphate and isopentenyl diphosphate. GGPP is an important molecule responsible for the C20-prenylation of proteins and for the regulation of a nuclear hormone receptor. Alternate transcriptional splice variants, both protein-coding and non-protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
Transcript Variant: This variant (2) encodes the functional protein.
Write Your Own Review
You're reviewing:GGPS1 (NM_001037277) Human Untagged Clone
Your Rating
SKU Description Size Price
RC215732 GGPS1 (Myc-DDK-tagged)-Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 2 10 ug
$300.00
RC215732L3 Lenti ORF clone of Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC215732L4 Lenti ORF clone of Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 2, mGFP tagged 10 ug
$600.00
RG215732 GGPS1 (tGFP-tagged) - Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.