NABP1 (NM_001031716) Human Untagged Clone

SKU
SC302561
NABP1 (untagged)-Human oligonucleotide/oligosaccharide-binding fold containing 2A (OBFC2A), transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NABP1
Synonyms OBFC2A; SOSS-B2; SSB2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001031716 edited
ATGAATAGGGTCAACGACCCACTTATTTTTATAAGAGATATTAAGCCCGGACTGAAAAAC
TTAAATGTCGTCTTTATTGTCCTGGAGATAGGACGCGTGACCAAAACCAAAGACGGCCAT
GAAGTGAGATCGTGCAAAGTAGCAGATAAAACGGGCAGCATCACTATTTCCGTGTGGGAT
GAGATCGGAGGTCTTATACAGCCAGGGGATATTATTCGGTTGACCAGAGGGTATGCATCC
ATGTGGAAAGGATGTCTGACACTTTATACTGGAAGGGGTGGTGAACTTCAAAAAATTGGG
GAATTTTGTATGGTTTATTCAGAAGTGCCAAATTTCAGTGAACCCAACCCAGATTATCGA
GGACAGCAGAACAAAGGGGCACAGAGTGAACAGAAGAATAATTCCATGAATAGTAATATG
GGTACAGGTACATTTGGACCAGTGGGAAATGGTGTTCACACTGGCCCTGAATCAAGGGAA
CACCAGTTTTCACATGCTGGCAGAAGCAATGGCCGGGGACTTATAAATCCACAACTACAA
GGAACAGCTAGTAATCAAACAGTGATGACCACAATAAGTAATGGCAGGGACCCTCGGAGA
GCCTTTAAAAGATGA
Restriction Sites Please inquire
ACCN NM_001031716
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001031716.1, NP_001026886.1
RefSeq Size 1879 bp
RefSeq ORF 615 bp
Locus ID 64859
UniProt ID Q96AH0
Cytogenetics 2q32.3
Summary Single-stranded DNA (ssDNA)-binding proteins, such as OBFC2A, are ubiquitous and essential for a variety of DNA metabolic processes, including replication, recombination, and detection and repair of damage (Richard et al., 2008 [PubMed 18449195]).[supplied by OMIM, Jun 2008]
Transcript Variant: This variant (1) encodes the longer isoform (1).
Write Your Own Review
You're reviewing:NABP1 (NM_001031716) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203672 NABP1 (Myc-DDK-tagged)-Human oligonucleotide/oligosaccharide-binding fold containing 2A (OBFC2A), transcript variant 1 10 ug
$300.00
RC203672L3 Lenti ORF clone of Human oligonucleotide/oligosaccharide-binding fold containing 2A (OBFC2A), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC203672L4 Lenti ORF clone of Human oligonucleotide/oligosaccharide-binding fold containing 2A (OBFC2A), transcript variant 1, mGFP tagged 10 ug
$600.00
RG203672 NABP1 (tGFP-tagged) - Human oligonucleotide/oligosaccharide-binding fold containing 2A (OBFC2A), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.