CYP11B1 (NM_001026213) Human Untagged Clone

SKU
SC302433
CYP11B1 (untagged)-Human cytochrome P450, family 11, subfamily B, polypeptide 1 (CYP11B1), nuclear gene encoding mitochondrial protein, transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CYP11B1
Synonyms CPN1; CYP11B; FHI; P450C11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC302433 representing NM_001026213.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCACTCAGGGCAAAGGCAGAGGTGTGCATGGCAGTGCCCTGGCTGTCCCTGCAAAGGGCACAGGCA
CTGGGCACGAGAGCCGCCCGGGTCCCCAGGACAGTGCTGCCCTTTGAAGCCATGCCCCGGCGTCCAGGC
AACAGGTGGCTGAGGCTGCTGCAGATCTGGAGGGAGCAGGGTTATGAGGACCTGCACCTGGAAGTACAC
CAGACCTTCCAGGAACTAGGGCCCATTTTCAGGTACGACTTGGGAGGAGCAGGCATGGTGTGTGTGATG
CTGCCGGAGGACGTGGAGAAGCTGCAACAGGTGGACAGCCTGCATCCCCACAGGATGAGCCTGGAGCCC
TGGGTGGCCTACAGACAACATCGTGGGCACAAATGTGGCGTGTTCTTGCTGAATGGGCCTGAATGGCGC
TTCAACCGATTGCGGCTGAATCCAGAAGTGCTGTCGCCCAACGCTGTGCAGAGGTTCCTCCCGATGGTG
GATGCAGTGGCCAGGGACTTCTCCCAGGCCCTGAAGAAGAAGGTGCTGCAGAACGCCCGGGGGAGCCTG
ACCCTGGACGTCCAGCCCAGCATCTTCCACTACACCATAGAAGCCAGCAACTTGGCTCTTTTTGGAGAG
CGGCTGGGCCTGGTTGGCCACAGCCCCAGTTCTGCCAGCCTGAACTTCCTCCATGCCCTGGAGGTCATG
TTCAAATCCACCGTCCAGCTCATGTTCATGCCCAGGAGCCTGTCTCGCTGGACCAGCCCCAAGGTGTGG
AAGGAGCACTTTGAGGCCTGGGACTGCATCTTCCAGTACGGCGACAACTGTATCCAGAAAATCTATCAG
GAACTGGCCTTCAGCCGCCCTCAACAGTACACCAGCATCGTGGCGGAGCTCCTGTTGAATGCGGAACTG
TCGCCAGATGCCATCAAGGCCAACTCTATGGAACTCACTGCAGGGAGCGTGGACACGACGGTGTTTCCC
TTGCTGATGACGCTCTTTGAGCTGGCTCGGAACCCCAACGTGCAGCAGGCCCTGCGCCAGGAGAGCCTG
GCCGCCGCAGCCAGCATCAGTGAACATCCCCAGAAGGCAACCACCGAGCTGCCCTTGCTGCGTGCGGCC
CTCAAGGAGACCTTGCGGCTCTACCCTGTGGGTCTGTTTCTGGAGCGAGTGGCGAGCTCAGACTTGGTG
CTTCAGAACTACCACATCCCAGCTGGGGTGCTGAAACACCTCCAGGTGGAGACACTAACCCAAGAGGAC
ATAAAGATGGTCTACAGCTTCATATTGAGGCCCAGCATGTTCCCCCTCCTCACCTTCAGAGCCATCAAC
TAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001026213
Insert Size 1314 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001026213.1
RefSeq Size 3353 bp
RefSeq ORF 1314 bp
Locus ID 1584
UniProt ID P15538
Cytogenetics 8q24.3
Protein Families Druggable Genome, P450
Protein Pathways Androgen and estrogen metabolism, C21-Steroid hormone metabolism, Metabolic pathways
MW 49.7 kDa
Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and is involved in the conversion of progesterone to cortisol in the adrenal cortex. Mutations in this gene cause congenital adrenal hyperplasia due to 11-beta-hydroxylase deficiency. Transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an in-frame coding exon compared to transcript variant 1. This results in an isoform (2) that is missing a 66 aa segment compared to isoform 1.
Write Your Own Review
You're reviewing:CYP11B1 (NM_001026213) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221240 CYP11B1 (Myc-DDK-tagged)-Human cytochrome P450, family 11, subfamily B, polypeptide 1 (CYP11B1), nuclear gene encoding mitochondrial protein, transcript variant 2 10 ug
$457.00
RC221240L3 Lenti ORF clone of Human cytochrome P450, family 11, subfamily B, polypeptide 1 (CYP11B1), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC221240L4 Lenti ORF clone of Human cytochrome P450, family 11, subfamily B, polypeptide 1 (CYP11B1), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged 10 ug
$757.00
RG221240 CYP11B1 (tGFP-tagged) - Human cytochrome P450, family 11, subfamily B, polypeptide 1 (CYP11B1), nuclear gene encoding mitochondrial protein, transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.