U2AF35 (U2AF1) (NM_001025203) Human Untagged Clone

SKU
SC302367
U2AF1 (untagged)-Human U2 small nuclear RNA auxiliary factor 1 (U2AF1), transcript variant b
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol U2AF35
Synonyms FP793; RN; RNU2AF1; U2AF35; U2AFBP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC302367 representing NM_001025203.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGAGTATCTGGCCTCCATCTTCGGCACCGAGAAAGACAAAGTCAACTGTTCATTTTATTTCAAA
ATTGGAGCATGTCGTCATGGAGACAGGTGCTCTCGGTTGCACAATAAACCGACGTTTAGCCAGACCATC
TTGATTCAAAACATCTATCGTAATCCCCAAAACAGTGCACAGACGGCTGACGGCTCACACTGTGCCGTG
AGCGATGTGGAGATGCAGGAACACTATGATGAGTTTTTTGAGGAGGTTTTTACAGAAATGGAGGAGAAG
TATGGGGAAGTAGAGGAGATGAACGTCTGTGACAACCTGGGAGACCACCTGGTGGGGAACGTGTACGTC
AAGTTTCGCCGTGAGGAAGATGCGGAAAAGGCTGTGATTGACTTGAATAACCGTTGGTTTAATGGACAG
CCGATCCACGCCGAGCTGTCACCCGTGACGGACTTCAGAGAAGCCTGCTGCCGTCAGTATGAGATGGGA
GAATGCACACGAGGCGGCTTCTGCAACTTCATGCATTTGAAGCCCATTTCCAGAGAGCTGCGGCGGGAG
CTGTATGGCCGCCGTCGCAAGAAGCATAGATCAAGATCCCGATCCCGGGAGCGTCGTTCTCGGTCTAGA
GACCGTGGTCGTGGCGGTGGCGGTGGCGGTGGTGGAGGTGGCGGCGGACGGGAGCGTGACAGGAGGCGG
TCGAGAGATCGTGAAAGATCTGGGCGATTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001025203
Insert Size 723 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001025203.1
RefSeq Size 971 bp
RefSeq ORF 723 bp
Locus ID 7307
UniProt ID Q01081
Cytogenetics 21q22.3
Protein Families Stem cell - Pluripotency
Protein Pathways Spliceosome
MW 27.9 kDa
Summary This gene belongs to the splicing factor SR family of genes. U2 auxiliary factor, comprising a large and a small subunit, is a non-snRNP protein required for the binding of U2 snRNP to the pre-mRNA branch site. This gene encodes the small subunit which plays a critical role in both constitutive and enhancer-dependent RNA splicing by directly mediating interactions between the large subunit and proteins bound to the enhancers. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (b) lacks an in-frame segment of the coding region, compared to variant c. The resulting isoform (b) has a longer N-terminus when compared to isoform c.
Write Your Own Review
You're reviewing:U2AF35 (U2AF1) (NM_001025203) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221772 U2AF1 (Myc-DDK-tagged)-Human U2 small nuclear RNA auxiliary factor 1 (U2AF1), transcript variant b 10 ug
$289.00 MSRP $330.00 MSRP $330.00
RC221772L3 Lenti ORF clone of Human U2 small nuclear RNA auxiliary factor 1 (U2AF1), transcript variant b, Myc-DDK-tagged 10 ug
$630.00
RC221772L4 Lenti ORF clone of Human U2 small nuclear RNA auxiliary factor 1 (U2AF1), transcript variant b, mGFP tagged 10 ug
$630.00
RG221772 U2AF1 (tGFP-tagged) - Human U2 small nuclear RNA auxiliary factor 1 (U2AF1), transcript variant b 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.