Bcl 7A (BCL7A) (NM_001024808) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Bcl 7A |
Synonyms | BCL7 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC302300 representing NM_001024808.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGGGCAGGTCGGTTCGAGCCGAGACGAGGAGCCGGGCCAAAGATGATATCAAGAGGGTCATGGCG GCGATCGAGAAAGTGCGCAAATGGGAGAAGAAATGGGTGACCGTTGGTGACACATCCCTACGAATCTAC AAATGGGTCCCTGTGACGGAGCCCAAGGTTGATGACAAAAACAAGAATAAGAAAAAAGGCAAGGACGAG AAGTGTGGCTCAGAGGTGACCACTCCGGAGAACAGTTCCTCCCCAGGGATGATGGACATGCATGACGAT AACAGCAACCAGAGCTCCATCGCAGATGCCTCCCCCATCAAACAGGAGAACAGCAGCAACTCCAGCCCC GCTCCAGAGCCCAACTCGGCTGTGCCCAGCGACGGCACCGAGGCCAAGGTGGATGAGGCCCAGGCTGAT GGGAAGGAGCACCCAGGAGCTGAAGATGCTTCTGATGAGCAGAATTCACAGTCCTCGATGGAACATTCG ATGAACAGCTCAGAGAAAGTAGATCGGCAGCCGTCTGGAGACTCGGGTCTGGCCGCAGAGACGTCTGCA ATCTCTCAGGATTTGGAAGGAGTGCCACCCTCTAAAAAGATGAAACTGGAGGCCTCTCAACAAAACTCC GAAGAGATGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001024808 |
Insert Size | 633 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001024808.2 |
RefSeq Size | 3720 bp |
RefSeq ORF | 633 bp |
Locus ID | 605 |
UniProt ID | Q4VC05 |
Cytogenetics | 12q24.31 |
Protein Families | Druggable Genome |
MW | 22.8 kDa |
Summary | This gene is directly involved, with Myc and IgH, in a three-way gene translocation in a Burkitt lymphoma cell line. As a result of the gene translocation, the N-terminal region of the gene product is disrupted, which is thought to be related to the pathogenesis of a subset of high-grade B cell non-Hodgkin lymphoma. The N-terminal segment involved in the translocation includes the region that shares a strong sequence similarity with those of BCL7B and BCL7C. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC210489 | BCL7A (Myc-DDK-tagged)-Human B-cell CLL/lymphoma 7A (BCL7A), transcript variant 2 | 10 ug |
$300.00
|
|
RC210489L1 | Lenti ORF clone of Human B-cell CLL/lymphoma 7A (BCL7A), transcript variant 2, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC210489L2 | Lenti ORF clone of Human B-cell CLL/lymphoma 7A (BCL7A), transcript variant 2, mGFP tagged | 10 ug |
$600.00
|
|
RC210489L3 | Lenti ORF clone of Human B-cell CLL/lymphoma 7A (BCL7A), transcript variant 2, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC210489L4 | Lenti ORF clone of Human B-cell CLL/lymphoma 7A (BCL7A), transcript variant 2, mGFP tagged | 10 ug |
$600.00
|
|
RG210489 | BCL7A (tGFP-tagged) - Human B-cell CLL/lymphoma 7A (BCL7A), transcript variant 2 | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.