C4BPB (NM_001017367) Human Untagged Clone
SKU
SC302020
C4BPB (untagged)-Human complement component 4 binding protein, beta (C4BPB), transcript variant 5
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | C4BPB |
Synonyms | C4BP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC302020 representing NM_001017367.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTTTTTTGGTGTGCGTGCTGTCTTATGGTTGCGTGGCGAGTTTCTGCTTCAGATGCAGAGCACTGT CCAGAGCTTCCTCCAGTGGACAATAGCATATTTGTCGCAAAGGAGGTGGAAGGACAGATTCTGGGGACT TACGTTTGTATCAAGGGCTACCACCTGGTAGGAAAGAAGACCCTTTTTTGCAATGCCTCTAAGGAGTGG GATAACACCACTACTGAGTGCCGCTTGGGCCACTGTCCTGATCCTGTGCTGGTGAATGGAGAGTTCAGT TCTTCAGGGCCTGTGAATGTAAGTGACAAAATCACGTTTATGTGCAATGACCACTACATCCTCAAGGGC AGCAATCGGAGCCAGTGTCTAGAGGACCACACCTGGGCACCTCCCTTTCCCATCTGCAAAAGTAGGGAC TGTGACCCTCCTGGGAATCCAGTTCATGGCTATTTTGAAGGAAATAACTTCACCTTAGGATCCACCATT AGTTATTACTGTGAAGACAGGTACTACTTAGTGGGCGTGCAGGAGCAGCAATGCGTTGATGGGGAGTGG AGCAGTGCACTTCCAGTCTGCAAGTTGATCCAGGAAGCTCCCAAACCAGAGTGTGAGAAGGCACTTCTT GCCTTTCAGGAGAGTAAGAACCTCTGCGAAGCCATGGAGAACTTTATGCAACAATTAAAGGAAAGTGGC ATGACAATGGAGGAGCTAAAATATTCTCTGGAGCTGAAGAAAGCTGAGTTGAAGGCAAAATTGTTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001017367 |
Insert Size | 759 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001017367.1 |
RefSeq Size | 967 bp |
RefSeq ORF | 759 bp |
Locus ID | 725 |
UniProt ID | P20851 |
Cytogenetics | 1q32.1 |
Protein Pathways | Complement and coagulation cascades |
MW | 28.4 kDa |
Summary | This gene encodes a member of a superfamily of proteins composed predominantly of tandemly arrayed short consensus repeats of approximately 60 amino acids. A single, unique beta-chain encoded by this gene assembles with seven identical alpha-chains into the predominant isoform of C4b-binding protein, a multimeric protein that controls activation of the complement cascade through the classical pathway. C4b-binding protein has a regulatory role in the coagulation system also, mediated through the beta-chain binding of protein S, a vitamin K-dependent protein that serves as a cofactor of activated protein C. The genes encoding both alpha and beta chains are located adjacent to each other on human chromosome 1 in the regulator of complement activation gene cluster. Alternative splicing gives rise to multiple transcript variants. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (5) differs in the 5' UTR, compared to variant 1. Variants 1, 3 and 5 encode the same isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC219216 | C4BPB (Myc-DDK-tagged)-Human complement component 4 binding protein, beta (C4BPB), transcript variant 5 | 10 ug |
$300.00
|
|
RC219216L3 | Lenti ORF clone of Human complement component 4 binding protein, beta (C4BPB), transcript variant 5, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC219216L4 | Lenti ORF clone of Human complement component 4 binding protein, beta (C4BPB), transcript variant 5, mGFP tagged | 10 ug |
$600.00
|
|
RG219216 | C4BPB (tGFP-tagged) - Human complement component 4 binding protein, beta (C4BPB), transcript variant 5 | 10 ug |
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.