BAG5 (NM_001015048) Human Untagged Clone

SKU
SC301988
BAG5 (untagged)-Human BCL2-associated athanogene 5 (BAG5), transcript variant 3
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol BAG5
Synonyms BAG-5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC301988 representing NM_001015048.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATATGGGAAACCAACATCCTTCTATTAGTAGGCTTCAGGAAATCCAAAAGGAAGTAAAAAGTGTA
GAACAGCAAGTTATCGGCTTCAGTGGTCTGTCAGATGACAAGAATTACAAGAAACTGGAGAGGATTCTA
ACAAAACAGCTTTTTGAAATAGACTCTGTAGATACTGAAGGAAAAGGAGATATTCAGCAAGCTAGGAAG
CGGGCAGCACAGGAGACAGAACGTCTTCTCAAAGAGTTGGAGCAGAATGCAAACCACCCACACCGGATT
GAAATACAGAACATTTTTGAGGAAGCCCAGTCCCTCGTGAGAGAGAAAATTGTGCCATTTTATAATGGA
GGCAACTGCGTAACTGATGAGTTTGAAGAAGGCATCCAAGATATCATTCTGAGGCTGACACATGTTAAA
ACTGGAGGAAAAATCTCCTTGCGGAAAGCAAGGTATCACACTTTAACCAAAATCTGTGCGGTGCAAGAG
ATAATCGAAGACTGCATGAAAAAGCAGCCTTCCCTGCCGCTTTCCGAGGATGCACATCCTTCCGTTGCC
AAAATCAACTTCGTGATGTGTGAGGTGAACAAGGCCCGAGGGGTCCTGATTGCACTTCTGATGGGTGTG
AACAACAATGAGACCTGCAGGCACTTATCCTGTGTGCTCTCGGGGCTGATCGCTGACCTGGATGCTCTA
GATGTGTGCGGCCGGACAGAAATCAGAAATTATCGGAGGGAGGTAGTAGAAGATATCAACAAATTATTG
AAATATCTGGATTTGGAAGAGGAAGCAGACACAACTAAAGCATTTGACCTGAGACAGAATCATTCCATT
TTAAAAATAGAAAAGGTCCTCAAGAGAATGAGAGAAATAAAAAATGAACTTCTCCAAGCACAAAACCCT
TCTGAATTGTACCTGAGCTCCAAAACAGAATTGCAGGGTTTAATTGGACAGTTGGATGAGGTAAGTCTT
GAAAAAAACCCCTGCATCCGGGAAGCCAGGAGAAGAGCAGTGATCGAGGTGCAAACTCTGATCACATAT
ATTGACTTGAAGGAGGCCCTTGAGAAAAGAAAGCTGTTTGCTTGTGAGGAGCACCCATCCCATAAAGCC
GTCTGGAACGTCCTTGGAAACTTGTCTGAGATCCAGGGAGAAGTTCTTTCATTTGATGGAAATCGAACC
GATAAGAACTACATCCGGCTGGAAGAGCTGCTCACCAAGCAGCTGCTAGCCCTGGATGCTGTTGATCCG
CAGGGAGAAGAGAAGTGTAAGGCTGCCAGGAAACAAGCTGTGAGGCTTGCGCAGAATATTCTCAGCTAT
CTCGACCTGAAATCTGATGAATGGGAGTACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001015048
Insert Size 1344 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001015048.2
RefSeq Size 4866 bp
RefSeq ORF 1344 bp
Locus ID 9529
UniProt ID Q9UL15
Cytogenetics 14q32.33
Protein Families Druggable Genome
MW 51.2 kDa
Summary The protein encoded by this gene is a member of the BAG1-related protein family. BAG1 is an anti-apoptotic protein that functions through interactions with a variety of cell apoptosis and growth related proteins including BCL-2, Raf-protein kinase, steroid hormone receptors, growth factor receptors and members of the heat shock protein 70 kDa family. This protein contains a BAG domain near the C-terminus, which could bind and inhibit the chaperone activity of Hsc70/Hsp70. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2 and 3 both encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:BAG5 (NM_001015048) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212765 BAG5 (Myc-DDK-tagged)-Human BCL2-associated athanogene 5 (BAG5), transcript variant 3 10 ug
$457.00
RC212765L3 Lenti ORF clone of Human BCL2-associated athanogene 5 (BAG5), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC212765L4 Lenti ORF clone of Human BCL2-associated athanogene 5 (BAG5), transcript variant 3, mGFP tagged 10 ug
$757.00
RG212765 BAG5 (tGFP-tagged) - Human BCL2-associated athanogene 5 (BAG5), transcript variant 3 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.