DPRX (NM_001012728) Human Untagged Clone

SKU SC301711

DPRX (untagged)-Human divergent-paired related homeobox (DPRX)

Product Data

• Type: Human Untagged Clone
• Target Symbol: DPRX
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001012728 edited; ATGCCAGGCTCAGAGGATCTTCGTAAAGGCAAGGACCAGATGCATTCACACAGGAAACGA; ACCATGTTCACTAAGAAGCAACTGGAAGATCTGAACATCTTGTTCAATGAGAACCCATAC; CCAAACCCCAGCCTTCAGAAAGAAATGGCCTCGAAAATAGACATACACCCAACAGTACTG; CAGGTCTGGTTCAAGAATCACAGAGCAAAACTCAAGAAAGCGAAATGCAAGCATATTCAT; CAAAAACAAGAAACTCCACAACCGCCAATACCAGAGGGTGGGGTCTCCACCAGTGTCGGC; CTGAGAAATGCAGACACACTACCCAGATTGCCCAACGCTGCTCACCCGATCGGCCTGGTG; TACACGGGTCATCGAGTCCCCTCATTCCAGCTCATCCTGTACCCCAACCTCAAGGTCCCT; GCAAATGACTTCATTGGCCACAGAATAGTCCATTTTGGCTGCTGCCGAGATCCTAATATA; TACTGCCTCTACCCCATTTTGGAATCCCAAGTTTGCGCTCCAAGCTTCCATTCTGGCTCT; CCTGCCTGTTCATCTAACCAAAGTCGAGAGAGATGA;
• Restriction Sites: Please inquire
• ACCN: NM_001012728
• Insert Size: 600 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001012728.1, NP_001012746.1
• RefSeq Size: 648 bp
• RefSeq ORF: 576 bp
• Locus ID: 503834
• UniProt ID: A6NFQ7
• Cytogenetics: 19q13.42
• Summary: Homeobox genes encode DNA-binding proteins, many of which are thought to be involved in early embryonic development. Homeobox genes encode a DNA-binding domain of 60 to 63 amino acids referred to as the homeodomain. This gene is a member of the DPRX homeobox gene family. Evidence of mRNA expression has not yet been found for this gene. Multiple, related processed pseudogenes have been found which are thought to reflect expression of this gene in the germ line or embryonic cells. [provided by RefSeq, Jul 2008]