LDLRAD1 (NM_001010978) Human Untagged Clone

SKU
SC301553
LDLRAD1 (untagged)-Human low density lipoprotein receptor class A domain containing 1 (LDLRAD1)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LDLRAD1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC301553 representing NM_001010978.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACAAGGTCTTCCCCCAGGGAGAGAATGGCTACACTGCTGCTGAATCCAAAGCCCACCCTGGAGGG
GAAGCAGGCGGCGGCCACCTCTGCTGCTCACGTCGCGGGGCCTGCCTCTCTGCCTCTCTGCTGCTCCTC
CTGGCAACTGTGGCGGCCCTCATCGCCTTGGTCACCATTCTTGGACTCCCATCATGCACCCCAGGAGCC
CAAGCTTGTATAACACTGACAAACAGGACAGGCTTCTTGTGCCATGACCAGAGGAGCTGCATTCCAGCC
AGTGGGGTCTGTGATGGCGTTCGCACCTGTACCCACGGCGAGGACGAGGATGAGAGCTTGTGCCGAGAT
GTGCCCCAGAGCCTCCCCCACTTCCTTGTGGCCCACTGTGGAGACCCGGCCTCCTGGATCTACTCAGAC
CAAAAATGTGATGGCACTAACAACTGCGGGGACTGTTCAGATGAACTGAGCCCAGTAACTGTGTGCCCA
CCCTGCGGCCCTGGGTGGTGGCGCTGTCCTTCAACCTTCTTCAAGTACTGCGACTGTATACCGAGGCAT
CTCTGCCGCGACCATGTACAGCACTGCTCCGACTGGTCCGATGAGTATGCCTGTCCCGGACCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001010978
Insert Size 618 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001010978.3
RefSeq Size 2393 bp
RefSeq ORF 618 bp
Locus ID 388633
UniProt ID Q5T700
Cytogenetics 1p32.3
Protein Families Transmembrane
MW 21.8 kDa
Write Your Own Review
You're reviewing:LDLRAD1 (NM_001010978) Human Untagged Clone
Your Rating
SKU Description Size Price
RC220030 LDLRAD1 (Myc-DDK-tagged)-Human low density lipoprotein receptor class A domain containing 1 (LDLRAD1) 10 ug
$300.00
RC220030L1 Lenti ORF clone of Human low density lipoprotein receptor class A domain containing 1 (LDLRAD1), Myc-DDK-tagged 10 ug
$600.00
RC220030L2 Lenti ORF clone of Human low density lipoprotein receptor class A domain containing 1 (LDLRAD1), mGFP tagged 10 ug
$600.00
RC220030L3 Lenti ORF clone of Human low density lipoprotein receptor class A domain containing 1 (LDLRAD1), Myc-DDK-tagged 10 ug
$600.00
RC220030L4 Lenti ORF clone of Human low density lipoprotein receptor class A domain containing 1 (LDLRAD1), mGFP tagged 10 ug
$600.00
RG220030 LDLRAD1 (tGFP-tagged) - Human low density lipoprotein receptor class A domain containing 1 (LDLRAD1) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.